ID: 909522577

View in Genome Browser
Species Human (GRCh38)
Location 1:76586852-76586874
Sequence CACTTTTAACAGCATCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909522577_909522580 13 Left 909522577 1:76586852-76586874 CCAAGTGGATGCTGTTAAAAGTG No data
Right 909522580 1:76586888-76586910 TGCCTTTCCTATTTCTGTACAGG 0: 1
1: 0
2: 2
3: 21
4: 170
909522577_909522578 -10 Left 909522577 1:76586852-76586874 CCAAGTGGATGCTGTTAAAAGTG No data
Right 909522578 1:76586865-76586887 GTTAAAAGTGAATCTATCCATGG 0: 1
1: 0
2: 1
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909522577 Original CRISPR CACTTTTAACAGCATCCACT TGG (reversed) Intronic
No off target data available for this crispr