ID: 909530970

View in Genome Browser
Species Human (GRCh38)
Location 1:76681415-76681437
Sequence CTTCTCAGTGGAGTACAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909530970_909530973 -10 Left 909530970 1:76681415-76681437 CCAGGTTGTACTCCACTGAGAAG No data
Right 909530973 1:76681428-76681450 CACTGAGAAGGTTCATATATTGG No data
909530970_909530976 25 Left 909530970 1:76681415-76681437 CCAGGTTGTACTCCACTGAGAAG No data
Right 909530976 1:76681463-76681485 TACTGTAATAAAAGTGTGTGTGG No data
909530970_909530974 -9 Left 909530970 1:76681415-76681437 CCAGGTTGTACTCCACTGAGAAG No data
Right 909530974 1:76681429-76681451 ACTGAGAAGGTTCATATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909530970 Original CRISPR CTTCTCAGTGGAGTACAACC TGG (reversed) Intergenic
No off target data available for this crispr