ID: 909531953

View in Genome Browser
Species Human (GRCh38)
Location 1:76691925-76691947
Sequence GGAGAACACCACCAAAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909531949_909531953 7 Left 909531949 1:76691895-76691917 CCAGATCTCATAAGAACTCACTC 0: 32
1: 764
2: 2042
3: 2706
4: 2761
Right 909531953 1:76691925-76691947 GGAGAACACCACCAAAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909531953 Original CRISPR GGAGAACACCACCAAAGGGA TGG Intergenic
No off target data available for this crispr