ID: 909534837

View in Genome Browser
Species Human (GRCh38)
Location 1:76725014-76725036
Sequence TGCCATGGGGATGTTTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909534837_909534843 -6 Left 909534837 1:76725014-76725036 CCCCAGGAAACATCCCCATGGCA No data
Right 909534843 1:76725031-76725053 ATGGCACTGTCAAACACAAATGG No data
909534837_909534844 2 Left 909534837 1:76725014-76725036 CCCCAGGAAACATCCCCATGGCA No data
Right 909534844 1:76725039-76725061 GTCAAACACAAATGGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909534837 Original CRISPR TGCCATGGGGATGTTTCCTG GGG (reversed) Intergenic
No off target data available for this crispr