ID: 909539037

View in Genome Browser
Species Human (GRCh38)
Location 1:76770472-76770494
Sequence CCCATTTGTCCCCACTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909539034_909539037 -3 Left 909539034 1:76770452-76770474 CCTGGTAAATTTGCCTAGCTCCC No data
Right 909539037 1:76770472-76770494 CCCATTTGTCCCCACTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909539037 Original CRISPR CCCATTTGTCCCCACTTATT TGG Intergenic
No off target data available for this crispr