ID: 909540867

View in Genome Browser
Species Human (GRCh38)
Location 1:76790057-76790079
Sequence GAAGTAGCTGTAGCATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909540867_909540872 30 Left 909540867 1:76790057-76790079 CCAAAGGATGCTACAGCTACTTC No data
Right 909540872 1:76790110-76790132 AGAATGTGCTCTTCAAAGGCAGG No data
909540867_909540871 26 Left 909540867 1:76790057-76790079 CCAAAGGATGCTACAGCTACTTC No data
Right 909540871 1:76790106-76790128 CCTAAGAATGTGCTCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909540867 Original CRISPR GAAGTAGCTGTAGCATCCTT TGG (reversed) Intergenic
No off target data available for this crispr