ID: 909546798

View in Genome Browser
Species Human (GRCh38)
Location 1:76857341-76857363
Sequence ATGACGGCACACATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909546798_909546807 12 Left 909546798 1:76857341-76857363 CCTTCCTCAATGTGTGCCGTCAT No data
Right 909546807 1:76857376-76857398 CCTGGTTTAGCCAGGAGCGCAGG No data
909546798_909546804 4 Left 909546798 1:76857341-76857363 CCTTCCTCAATGTGTGCCGTCAT No data
Right 909546804 1:76857368-76857390 CTTGACTCCCTGGTTTAGCCAGG No data
909546798_909546808 13 Left 909546798 1:76857341-76857363 CCTTCCTCAATGTGTGCCGTCAT No data
Right 909546808 1:76857377-76857399 CTGGTTTAGCCAGGAGCGCAGGG No data
909546798_909546801 -6 Left 909546798 1:76857341-76857363 CCTTCCTCAATGTGTGCCGTCAT No data
Right 909546801 1:76857358-76857380 CGTCATCACCCTTGACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909546798 Original CRISPR ATGACGGCACACATTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr