ID: 909549718

View in Genome Browser
Species Human (GRCh38)
Location 1:76884188-76884210
Sequence CTGTCTGCACAGACACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909549718_909549722 11 Left 909549718 1:76884188-76884210 CCCTCCTGTGTCTGTGCAGACAG No data
Right 909549722 1:76884222-76884244 ATTCTCCAACAGAAGGTTTGTGG No data
909549718_909549721 4 Left 909549718 1:76884188-76884210 CCCTCCTGTGTCTGTGCAGACAG No data
Right 909549721 1:76884215-76884237 AATGCAGATTCTCCAACAGAAGG 0: 1
1: 0
2: 0
3: 29
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909549718 Original CRISPR CTGTCTGCACAGACACAGGA GGG (reversed) Intronic
No off target data available for this crispr