ID: 909551702

View in Genome Browser
Species Human (GRCh38)
Location 1:76905206-76905228
Sequence AGGGGTAGAGACTCTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909551698_909551702 23 Left 909551698 1:76905160-76905182 CCTAAAGATAGAGAGCACATCGT No data
Right 909551702 1:76905206-76905228 AGGGGTAGAGACTCTGAGAAAGG 0: 1
1: 0
2: 7
3: 56
4: 377
909551697_909551702 24 Left 909551697 1:76905159-76905181 CCCTAAAGATAGAGAGCACATCG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 909551702 1:76905206-76905228 AGGGGTAGAGACTCTGAGAAAGG 0: 1
1: 0
2: 7
3: 56
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909551702 Original CRISPR AGGGGTAGAGACTCTGAGAA AGG Intronic
900609632 1:3539096-3539118 AGGGGTAGAGGATCAGGGAAAGG + Intronic
900840633 1:5046058-5046080 AAGAGTAGAGACACAGAGAAGGG - Intergenic
902050697 1:13561718-13561740 AAAGGTAGAGACACGGAGAAGGG - Intergenic
902379074 1:16044178-16044200 AGGGGAAGGGGCTCTGAGCAGGG + Intronic
903755421 1:25657300-25657322 TGGGGAAGAGGCACTGAGAAAGG - Intronic
904455089 1:30642694-30642716 AGGGGTGGAGGCTCAGAGACAGG + Intergenic
905211760 1:36379243-36379265 AGAGGTAGAAAAACTGAGAAGGG - Intronic
905910561 1:41650379-41650401 GGAGGTACAGACTCTGAGGAAGG + Intronic
906521904 1:46472177-46472199 ATAGGGAGAGACTCTGTGAAGGG + Intergenic
906928341 1:50143107-50143129 AGGGATGGAGAACCTGAGAAAGG + Intronic
907783051 1:57584808-57584830 AGGGGTAGAGAAACTAATAATGG - Intronic
909494305 1:76261379-76261401 AGTGGTAGAGACCCAGACAATGG - Intronic
909551702 1:76905206-76905228 AGGGGTAGAGACTCTGAGAAAGG + Intronic
909978601 1:82072003-82072025 AAGAGTAGAGACACGGAGAAGGG + Intergenic
910730157 1:90386356-90386378 AGGGGTAGAGATTCTTATTAAGG + Intergenic
911510802 1:98805901-98805923 AGGGGTAGAGACACAGAGAGAGG + Intergenic
911966729 1:104381021-104381043 AGGGGTAGAGACACGGAGAGAGG - Intergenic
912813407 1:112810612-112810634 AAGGGTAAAGACACAGAGAAGGG - Intergenic
913244981 1:116863309-116863331 AAAGGTAGAGACACAGAGAAGGG - Intergenic
914241731 1:145857384-145857406 TGGGTTTGAGAGTCTGAGAAAGG - Intronic
915244190 1:154544532-154544554 AGGGGTAGAGTCTATGGGAGAGG + Intronic
915616650 1:157044519-157044541 AGGGGAAGAGGGGCTGAGAAAGG - Exonic
917554370 1:176068388-176068410 AGGATTAGAAACTCTGAGAGTGG + Intronic
918567828 1:185952806-185952828 AAGAGTAGAGACACGGAGAAGGG + Intronic
918714557 1:187769985-187770007 AAGAGTAGAGACACGGAGAACGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920839028 1:209538265-209538287 TGTGGTAGAAAATCTGAGAAGGG - Intergenic
921212265 1:212910711-212910733 AAGAGTAGAGACACGGAGAAGGG - Intergenic
922048265 1:221967177-221967199 AAGAGTAGAGACACAGAGAAGGG - Intergenic
923408772 1:233687934-233687956 AAGAGTAGAGACACGGAGAAGGG + Intergenic
923770886 1:236936739-236936761 AAGAGTAGAGACACGGAGAAGGG + Intergenic
924945305 1:248842539-248842561 AGGGGTGGCCTCTCTGAGAAAGG + Intronic
1064655577 10:17552136-17552158 AGCAGTAGAGAGACTGAGAAGGG + Intergenic
1064850717 10:19706204-19706226 ACAGCTAGAGACTCTGGGAAGGG + Intronic
1064934796 10:20667757-20667779 AGTGGTAGAGAATCACAGAAGGG + Intergenic
1066103521 10:32137955-32137977 AAAGGTAGAGACACAGAGAAGGG + Intergenic
1066437517 10:35407769-35407791 AAGGGTAGAGACACGGAGAAGGG + Intronic
1067360208 10:45572228-45572250 GAGGGTAGAGACACAGAGAAGGG - Intronic
1068437400 10:57010299-57010321 AGGGGTCTAGACACAGAGAATGG - Intergenic
1068748514 10:60563747-60563769 TGGGGCATAGACTCTGAGCATGG - Intronic
1068865084 10:61886505-61886527 AAGGGTAGAGACCCTCAGAGAGG + Intergenic
1069369400 10:67730626-67730648 AAGGATAGAGGCTCTAAGAAGGG + Intergenic
1069757047 10:70779749-70779771 AGGGTTAGAGGCTGTGGGAAGGG + Intronic
1070474781 10:76819790-76819812 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1071229290 10:83565869-83565891 AGGAGTGGATGCTCTGAGAAGGG - Intergenic
1071803649 10:89092893-89092915 AGGGATAGAGACAGGGAGAAAGG - Intergenic
1071916058 10:90296225-90296247 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1072005961 10:91247792-91247814 TGTGGTAGAGATTTTGAGAATGG + Intronic
1072580112 10:96733433-96733455 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1073392881 10:103193482-103193504 AGGGATGGAGACCCTCAGAAGGG - Intergenic
1073930415 10:108567821-108567843 AGAGGATGAGACCCTGAGAATGG - Intergenic
1074533246 10:114311124-114311146 AGGGCGTGAGACTCTGGGAAGGG + Intronic
1074635811 10:115316085-115316107 AGGGGAAGAAACTCAGAGGATGG - Intronic
1075248548 10:120846072-120846094 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1075644429 10:124088217-124088239 CGGGGTAGCGACTTTGAGATTGG - Intronic
1077235285 11:1479166-1479188 AGGAGCAGAGCCTCTGGGAAGGG + Intronic
1077578954 11:3404741-3404763 AGGGGTGGAGCTTCTGGGAAAGG + Intergenic
1079023312 11:16925895-16925917 AGGGGTAGAGAGGCTGAGGAGGG + Intronic
1079230366 11:18644212-18644234 AAGGGTAGAGACACGGAGAGGGG - Intergenic
1079241224 11:18723494-18723516 AGGGGCAATGACTGTGAGAAGGG + Intronic
1079395641 11:20060768-20060790 ATGGGCAGAGACTCTGAGGCAGG + Intronic
1079447313 11:20569010-20569032 AAGAGTAGAGACACAGAGAAGGG - Intergenic
1079672718 11:23188429-23188451 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1081356664 11:42121798-42121820 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1081534145 11:43985148-43985170 AGGAAAAGAGGCTCTGAGAAAGG - Intergenic
1081784421 11:45736851-45736873 AGGAGCAGAGGCTCTGAGAGGGG - Intergenic
1082954623 11:58856654-58856676 AGAGGGAGAGAGTCTGGGAACGG + Intronic
1082971673 11:59029340-59029362 AGAGGGAGAGAGTCTGGGAACGG + Intronic
1083892163 11:65600930-65600952 AGAGGCAGAGAGTCTGAGTAAGG - Intronic
1084157803 11:67324229-67324251 AAGAATAGAGAGTCTGAGAATGG - Intronic
1085431757 11:76457450-76457472 TTGGGTAGAGAAACTGAGAATGG + Intronic
1085934107 11:81123021-81123043 AAGGGTAGAGACACGGAGAAGGG - Intergenic
1086004863 11:82026390-82026412 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1086125456 11:83344612-83344634 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1087168065 11:95024051-95024073 AAGGGTAGAGACACAGAGAAGGG + Intergenic
1087196762 11:95310752-95310774 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1088447991 11:109952723-109952745 AGGGGTAGAAACTGTTTGAAAGG - Intergenic
1090107751 11:123870113-123870135 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1091617471 12:2060315-2060337 CAGGGTAGAGACTGTGAGACAGG + Intronic
1091886360 12:4019740-4019762 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1092789568 12:12059619-12059641 AAGAGTAGAGACACGGAGAAGGG - Intronic
1092859707 12:12709972-12709994 ATGGGAACAGAGTCTGAGAAGGG + Intergenic
1093438137 12:19161507-19161529 AGGGGTGGAGACACGGAGATGGG - Intronic
1094228984 12:28081168-28081190 AGAGGTAAAGACTCAAAGAAGGG + Intergenic
1094240905 12:28223449-28223471 AGGTATAGAGACTCAGAAAAAGG - Intronic
1095637509 12:44450995-44451017 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1096609864 12:52794048-52794070 AGGGGCCAAGACTCTGAGACAGG + Intronic
1097241482 12:57578538-57578560 TGGGTTAGAAACTTTGAGAAGGG - Intronic
1098099232 12:66996126-66996148 AGGGGTAGAGACTTTTAGAGTGG + Intergenic
1098230880 12:68370742-68370764 ATGTGCAGAGGCTCTGAGAAAGG - Intergenic
1098919749 12:76292639-76292661 AAGGGTAGAGACACAGAGAAGGG - Intergenic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1102080341 12:110092741-110092763 TGGGGCAAAGATTCTGAGAAAGG - Intergenic
1102604266 12:114056664-114056686 AAGGGTAGAGACACAGAGAAGGG - Intergenic
1103297818 12:119903273-119903295 AGGGGTAGAGAGACAGAGAGAGG - Intergenic
1104248153 12:127062536-127062558 AAGGGTGCAGACTCTAAGAAAGG + Intergenic
1106152666 13:27121201-27121223 AGGAGTAGAGACAGGGAGAAAGG + Intronic
1106943291 13:34799866-34799888 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1108282201 13:48871515-48871537 AAGGGTAGAGACACAGAGAAGGG + Intergenic
1108804027 13:54132204-54132226 AAGGGTAGGGACACGGAGAAGGG + Intergenic
1109709810 13:66145843-66145865 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1109857513 13:68151946-68151968 AGGGAGTGAGACTCTGGGAATGG + Intergenic
1110130429 13:72002105-72002127 AGTGGTGGTGACTCTGATAAAGG + Intergenic
1111630298 13:90840666-90840688 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1113324188 13:109266565-109266587 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1114399502 14:22396312-22396334 GGGGGTACAGATTTTGAGAAAGG + Intergenic
1114747223 14:25162595-25162617 AGGGGAAGAGACTATGACCAGGG + Intergenic
1116573308 14:46545148-46545170 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1116613361 14:47105379-47105401 AAGAGTAGAGACACGGAGAAGGG - Intronic
1118742605 14:68751187-68751209 AGAGGTAGAGGGTTTGAGAATGG + Intergenic
1119253149 14:73174849-73174871 AGGGGAGGAGAGGCTGAGAAGGG - Intronic
1119560485 14:75585536-75585558 AAGGGTAGAGACACAGAGAAGGG + Intronic
1119819460 14:77602078-77602100 AAGGGTAGAGACACGGAGAAGGG - Intronic
1119939600 14:78626187-78626209 AAGGGAAGTGAATCTGAGAAGGG - Intronic
1120454880 14:84718337-84718359 AGGCTTGGAGATTCTGAGAAGGG + Intergenic
1120618106 14:86732530-86732552 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1121193466 14:92049246-92049268 AAAGGTAGAGACACGGAGAAGGG + Exonic
1121833644 14:97073030-97073052 AGAGGAAGAGACACAGAGAAAGG - Intergenic
1121980733 14:98451661-98451683 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1122308576 14:100780657-100780679 AGGGGTAAAGACTTTGAGGTTGG - Intergenic
1122683031 14:103481158-103481180 AGGTGTAGAGACTCTGAGGTGGG + Intronic
1125045623 15:35239991-35240013 AAGAGTAGAGACACGGAGAAGGG - Intronic
1126912549 15:53431325-53431347 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1127931961 15:63602680-63602702 GGGGGTGAAGCCTCTGAGAAAGG + Intergenic
1128234504 15:66058616-66058638 AGGTCTAGAGGCTCTGAGGAAGG + Intronic
1128340133 15:66816773-66816795 CTGGGAAGAGACTCTGAGATGGG + Intergenic
1129117819 15:73375065-73375087 GGGGGAAGAGACTCTGAAAATGG + Intergenic
1129173447 15:73822115-73822137 AGAGGGAGAGGCTCTGAGGAGGG + Intergenic
1129730285 15:77926655-77926677 AGTGGTATGGACTCTGAGAGTGG + Intergenic
1130141198 15:81227806-81227828 GGTGGTAGAGGCACTGAGAATGG + Intronic
1130229696 15:82087218-82087240 AGGGGAAGAGTCTATGAAAAGGG - Intergenic
1130297918 15:82660170-82660192 AGGGGTAGAGAGGCTGACAAAGG - Intronic
1131303703 15:91222460-91222482 AGGGGTAGATCTTCTGAGAATGG + Intronic
1131882661 15:96876318-96876340 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1132018431 15:98339338-98339360 AGGGGTAGAGACCCTGGCCATGG - Intergenic
1133347553 16:5080833-5080855 AGGGGTGGAGCTTCTGGGAAAGG + Intronic
1133765882 16:8837503-8837525 AAGAGTAGAGACACGGAGAAGGG + Intronic
1136428537 16:30184366-30184388 AGGGGCAGAGGCTCTGGGCATGG + Intronic
1139226066 16:65234325-65234347 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1139943195 16:70620948-70620970 AAGAGTAGAGACACGGAGAAGGG + Intronic
1141223442 16:82092604-82092626 AGGGACAGAGACCCAGAGAAAGG + Intronic
1143380588 17:6493748-6493770 TGGGGTAGTGTCTCTGTGAAAGG - Intronic
1143473081 17:7188304-7188326 AGGGGTAGTGATTCTGTGGATGG - Intergenic
1143795454 17:9332677-9332699 GGATGTAGAGACTCTGAAAAAGG - Intronic
1146210815 17:30941785-30941807 TGGGGTAGAGATTCTGCGAAGGG + Intronic
1146788720 17:35739489-35739511 AGGTGAAGAGACTCCTAGAAAGG - Intronic
1146895306 17:36536468-36536490 TGGGATATAAACTCTGAGAATGG - Intronic
1146927812 17:36757219-36757241 AGGGGCAGGGAGTCTGAGACTGG - Intergenic
1149319358 17:55468673-55468695 AAAGGTAGAGACACGGAGAAGGG - Intergenic
1149330140 17:55572386-55572408 AGGGTTAGTGACACAGAGAAGGG + Intergenic
1152453737 17:80400732-80400754 AAGGGTAGAGACACGGAGAAGGG - Intergenic
1153303294 18:3610496-3610518 AGGAGTAGGGACTCAGAGCATGG - Intronic
1153880441 18:9417656-9417678 AGGAGGAGAGTCTCTGATAAAGG - Intergenic
1153942756 18:9991713-9991735 CGGGGCAGAGAGGCTGAGAAGGG - Intergenic
1155697165 18:28697585-28697607 AAGAGTAGAGACACAGAGAAGGG + Intergenic
1155961794 18:32001458-32001480 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1156252087 18:35360829-35360851 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1158336230 18:56416814-56416836 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1159548732 18:69872803-69872825 ATGGATACAGATTCTGAGAAGGG - Intronic
1159834898 18:73325858-73325880 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1159963651 18:74575757-74575779 AGGGGAAGAGAAGTTGAGAAGGG + Intronic
1161062396 19:2221835-2221857 AGGGGTTGGGAGTCTGAAAACGG - Intronic
1161250315 19:3276476-3276498 AGGGGGAGAGGCCCTGGGAAGGG + Intronic
1161661570 19:5549710-5549732 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1161847225 19:6718839-6718861 AGGGGTGGAGTCTCAGAGAAGGG + Intronic
1161847285 19:6719033-6719055 AGGGGTGGAGTCTCAGAGAAGGG + Intronic
1161847299 19:6719084-6719106 AGGGGTGGAGTCTCAGGGAAGGG + Intronic
1162300180 19:9840451-9840473 AGGTTTGGGGACTCTGAGAAAGG - Intronic
1162756586 19:12864568-12864590 AGGGATGGAGACTCAAAGAAAGG - Intronic
1162948816 19:14058701-14058723 AGTGGTAGAGACCCAGAGATGGG + Intronic
1163209432 19:15829649-15829671 AGAAGTAGAGACACGGAGAAGGG - Intergenic
1163676298 19:18656932-18656954 AGGGACAGAGACTCAGAGACAGG - Intronic
1163676320 19:18657100-18657122 AGGGACAGAGACTCAGAGATAGG - Intronic
1163906886 19:20155787-20155809 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1164152819 19:22569450-22569472 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1164202654 19:23031327-23031349 GAGGGTAGAGACACAGAGAAGGG + Intergenic
1165497155 19:36159890-36159912 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1166076701 19:40417780-40417802 AGGGGTGGAGAATCTGGGGAGGG - Intergenic
1166184775 19:41132832-41132854 AGAGGCAGAGACTGAGAGAAAGG + Intergenic
1167046806 19:47054462-47054484 AGGGGTAGAGACACAGAGAAGGG + Intergenic
1167459128 19:49615164-49615186 AGGGACAGAGACCCAGAGAAGGG + Intronic
1167575143 19:50314411-50314433 AGGGGCAGGCACTCTGGGAAGGG - Intronic
1167608245 19:50493145-50493167 TGGGGGAGAGATTCAGAGAATGG + Intergenic
1168051435 19:53832489-53832511 AAGAGTAGAGACACGGAGAAGGG - Intergenic
925212526 2:2062103-2062125 GGGGGCAGAAACTGTGAGAAGGG - Intronic
925434008 2:3820416-3820438 GAGGGTAGAGACACGGAGAAGGG + Intronic
925611370 2:5705763-5705785 AGGGGTGGAGGACCTGAGAAGGG + Intergenic
925828974 2:7877163-7877185 AAGAGTAGAGACACAGAGAAGGG + Intergenic
925971917 2:9112070-9112092 ATGGGTAGAGAGGCAGAGAAGGG - Intergenic
926815700 2:16796443-16796465 AAGAGTAGAGACACGGAGAAGGG + Intergenic
927416108 2:22882224-22882246 ATGGGAAGAGACTGTGATAAGGG + Intergenic
929684691 2:44023569-44023591 AAGGGTAGAGACACGGAGAAGGG + Intergenic
930487521 2:52026632-52026654 AAGGGTAGAGACACGGAGAAGGG + Intergenic
930954948 2:57194194-57194216 AAGAGTAGAGACACGGAGAAGGG - Intergenic
931026542 2:58117897-58117919 AAGAGTAGAGACACAGAGAAGGG + Intronic
931042535 2:58315317-58315339 AAGAGTAGAGACACGGAGAAGGG - Intergenic
932367793 2:71164170-71164192 AAGAGTAGAGACACGGAGAAGGG + Intergenic
932442149 2:71744227-71744249 ATGGGCAGGGACTCTGAGGAAGG - Intergenic
932854360 2:75218289-75218311 AAGAGTAGAGACACTGAGAAGGG + Intergenic
933079126 2:77966331-77966353 AAGAGTAGAGACACGGAGAAGGG - Intergenic
933329667 2:80878952-80878974 AAGAGTAGAGACACAGAGAAGGG + Intergenic
934159194 2:89232060-89232082 GGGGGCAGAGACTGTGAGGAAGG + Intergenic
934167542 2:89308016-89308038 GGGGGCAGAGACTGTGAGGAAGG + Intergenic
934208078 2:89950365-89950387 GGGGGCAGAGACTGTGAGGAAGG - Intergenic
935349967 2:102144218-102144240 AAAGGTAGAGCCTTTGAGAATGG + Intronic
936514871 2:113175090-113175112 AGGGGGAGAGACCCACAGAAGGG + Intronic
936870636 2:117131494-117131516 AAAGGTAGAGACACGGAGAAGGG - Intergenic
936883193 2:117279965-117279987 AAGAGTAGAGACACGGAGAAGGG - Intergenic
937994321 2:127681301-127681323 AGAGGTAAAGACTCTGTGATGGG - Intronic
939307254 2:140427339-140427361 AAGGGTAAAGACACGGAGAAGGG - Intronic
939389499 2:141547972-141547994 AGTGGCAGAGACTTTGAGAAAGG + Intronic
940530038 2:154868530-154868552 AAGAGTAGAGACACAGAGAAGGG - Intergenic
940675954 2:156724571-156724593 AAGAGTAGAGACACAGAGAAGGG + Intergenic
941340256 2:164297075-164297097 AAGAGTAGAGACACGGAGAAGGG - Intergenic
941353237 2:164460340-164460362 AAGAGTAGAGACACGGAGAAGGG - Intergenic
941456350 2:165714997-165715019 AAGAGTAGAGACACAGAGAAGGG + Intergenic
942096915 2:172542873-172542895 AGGGGTAAAGACAGAGAGAAGGG - Intergenic
942730443 2:179056265-179056287 AAGAGTAGAGACACGGAGAAGGG + Intergenic
943085640 2:183307599-183307621 ATGGGACTAGACTCTGAGAATGG + Intergenic
943421729 2:187674956-187674978 AAGAGTAGAGACACGGAGAAGGG + Intergenic
943460335 2:188165384-188165406 GAGGGTAGAGACACAGAGAAGGG + Intergenic
943806494 2:192131643-192131665 AAGAGTAGAGACACGGAGAAGGG - Intronic
944123731 2:196269940-196269962 AGGGGTATAAATTCTGAGAAGGG + Intronic
945394156 2:209300447-209300469 AAGAGTAGAGACACGGAGAAGGG - Intergenic
946215182 2:218178511-218178533 AAGAGTAGAGACACGGAGAAGGG + Intergenic
946254847 2:218434896-218434918 AGAGGCAGAGAATCTGAGGATGG - Intronic
946412412 2:219521964-219521986 AGGGGCAGAGATCCTGAGAGTGG + Intronic
947104190 2:226651017-226651039 AGGGAGAGAGACTGAGAGAAAGG - Intergenic
948390532 2:237608164-237608186 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1169229040 20:3874827-3874849 AAGGGTATTGACTCTGAGAGGGG + Exonic
1170311391 20:14996585-14996607 AAGGGAAGAGACACTGAAAAGGG + Intronic
1170325709 20:15152634-15152656 AGGGGTAGAGACACAGAGAAGGG + Intronic
1170441832 20:16386964-16386986 AGGGGCAGTTAGTCTGAGAAAGG + Intronic
1170680596 20:18522137-18522159 AAGGGTAGAGACACGGAGTAGGG + Intronic
1171354589 20:24534290-24534312 AGGGGTGGAGGCTGTGAGGAGGG - Intronic
1173101704 20:40094247-40094269 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1173240115 20:41287808-41287830 ATGGGTTGAGAATCTGAGCAGGG - Intronic
1174351051 20:49968400-49968422 AAGGAGAGAGTCTCTGAGAAGGG + Intergenic
1177102531 21:16915187-16915209 GGGAGTAGAGACACGGAGAAGGG - Intergenic
1177453747 21:21307078-21307100 AAAGGTAGAGACTGTCAGAATGG - Intronic
1178001042 21:28162372-28162394 AAGGGTAGAGACACGGAGAAGGG - Intergenic
1179612545 21:42561834-42561856 AGGGGCGGGGCCTCTGAGAAGGG - Intronic
1180639448 22:17286676-17286698 AGAGGCAGAGACTTTGAGGACGG + Intergenic
1181672093 22:24430470-24430492 AGGTGGGGAGACCCTGAGAACGG + Intronic
1182113795 22:27743198-27743220 AAGAGTAGAGACACGGAGAAAGG - Intergenic
1182348734 22:29686186-29686208 AGGGGTTAAAACTCTGAAAAGGG + Intronic
1182349419 22:29690834-29690856 TGGGTTGGAGACTCTGAGCAGGG + Intronic
1182998451 22:34835554-34835576 AAGGGTAGAGACACAGAGAAGGG - Intergenic
1184433687 22:44456938-44456960 ATGGGCAGAGACTCTGGGAAGGG + Intergenic
1185390480 22:50558487-50558509 AAGGGTAGAGATTCTGAGGGAGG + Intronic
949162254 3:895178-895200 AAGAGTAGAGACACGGAGAAGGG + Intergenic
950534108 3:13569494-13569516 AGGGGTAGAGACCGTGGGGAGGG + Intronic
950640369 3:14344652-14344674 TTGGGAAGAGACCCTGAGAAAGG + Intergenic
950926346 3:16745525-16745547 AAGAGTAGAGACACGGAGAAGGG - Intergenic
951538401 3:23760536-23760558 AGGCCTAGAGACTCTGAGTGGGG - Intergenic
951864637 3:27294435-27294457 AGCAGTGGAGACTGTGAGAAAGG + Intronic
951894711 3:27599917-27599939 AAGGGTAGAGACACGGAGAAGGG - Intergenic
952214307 3:31261056-31261078 AGGGATACAGACTCAGAGTAAGG + Intergenic
952296661 3:32068417-32068439 AAGGGTAGAGACACGGAGAAGGG - Intronic
952379801 3:32795953-32795975 GAGGGTAGAGACACAGAGAAGGG + Intergenic
953774091 3:45800841-45800863 AGGGGTGGAGACACTGGGGAGGG + Intergenic
953840511 3:46386435-46386457 AAGGGAAGTGACTCAGAGAAGGG + Intergenic
954160485 3:48717908-48717930 AGGGTTAGTGCCACTGAGAATGG + Intronic
954463202 3:50639330-50639352 AGAGGTAGAGACTGGGGGAAGGG - Intronic
954662632 3:52234287-52234309 AGGGGTACAGACTTTGGGACTGG - Intronic
954969415 3:54638983-54639005 AAGAGTAGAGACACGGAGAAGGG + Intronic
956426593 3:69142217-69142239 CTTGGTAGAAACTCTGAGAAAGG - Intergenic
956709064 3:72024185-72024207 AAGAGTAGAGACACGGAGAAGGG - Intergenic
957051942 3:75418058-75418080 AGGGGTGGAGCTTCTGGGAAAGG + Intergenic
957394256 3:79619266-79619288 AAAGGTAGAGACACAGAGAAGGG - Intronic
958492226 3:94791511-94791533 AAGGGCAGTGACTCTGAAAAAGG + Intergenic
959296989 3:104548285-104548307 AGTAGTAGAGACTTTGAGTAGGG - Intergenic
961164916 3:124757039-124757061 AAGAGTAGAGACACGGAGAAGGG + Intergenic
961683242 3:128612839-128612861 AAGGGGAGAGTCTGTGAGAAAGG + Intergenic
961711776 3:128833690-128833712 AAGAGTAGAGACACGGAGAAGGG + Intergenic
961712924 3:128841063-128841085 AAGGGTAGAGACACAGAGAAGGG + Intergenic
962049248 3:131795501-131795523 AGTGGTAGAGTCTCTGTAAAGGG - Intronic
962524185 3:136222779-136222801 AAGGGTAGAGACATGGAGAAGGG + Intergenic
963319577 3:143798456-143798478 AAGGGTAGAGACATGGAGAAGGG - Intronic
965626543 3:170688168-170688190 AGGGGTAGAGACACAGAGAAGGG + Intronic
966105237 3:176326111-176326133 AAGAGTAGAGACACAGAGAAGGG + Intergenic
966279098 3:178208553-178208575 AGAGGTAGAGACACAGAGAAGGG - Intergenic
966398607 3:179525449-179525471 GAGGGTAGAGACACGGAGAAGGG + Intergenic
967005523 3:185379051-185379073 AAGGGTAGAGACACGGAGAAAGG + Intronic
967554735 3:190842521-190842543 AGGGATAGAGACTCTGAGAGTGG - Intergenic
967561238 3:190921327-190921349 AGCAGTAGAGACACGGAGAAGGG - Intergenic
967644053 3:191900183-191900205 AGGGGTAGAGACACGGAGAGAGG + Intergenic
968039845 3:195579673-195579695 AGGTGCAGAGGCTCTGAGGAAGG - Intronic
969161939 4:5267932-5267954 ATGGTTACCGACTCTGAGAAGGG + Intronic
969303489 4:6311197-6311219 TGGGGTGGAGAGTGTGAGAAGGG - Intergenic
969572317 4:8016496-8016518 GGGGAGACAGACTCTGAGAAAGG + Intronic
971123338 4:23726523-23726545 AAGAGTAGAGACACGGAGAAGGG + Intergenic
971180400 4:24324433-24324455 AAGAGTAGAGACACGGAGAAGGG - Intergenic
976318515 4:83685358-83685380 AAGGGTGGAGACTTTGTGAATGG - Intergenic
977198580 4:94089115-94089137 AAGAGTAGAGACACGGAGAAGGG + Intergenic
978155088 4:105480603-105480625 AGTGAGAGAGACTTTGAGAAAGG + Intergenic
979167840 4:117558823-117558845 AGGGGAAAAGTCTCTGAGGAAGG - Intergenic
979798484 4:124876701-124876723 AAAGGTAGAGACACGGAGAAGGG + Intergenic
979895315 4:126149628-126149650 AAGAGTAGAGACACGGAGAAGGG + Intergenic
980611924 4:135171783-135171805 AAGAGTAGAGACACGGAGAAGGG + Intergenic
982001052 4:151021470-151021492 AAGGGTAGAGACTTTGAAAAGGG + Intergenic
982132177 4:152239458-152239480 TGGGGCAGAGTCTCTTAGAAGGG + Intergenic
982180627 4:152745840-152745862 AAGAGTAGAGACACGGAGAAGGG + Intronic
982268713 4:153564893-153564915 AGGGGTAGAAGCTCTGAGCCTGG - Intronic
983414864 4:167440311-167440333 AAGAGTAGAGACACTGAGAAGGG + Intergenic
983452182 4:167924104-167924126 AAGAGTAGAGACACGGAGAAGGG - Intergenic
983535577 4:168853646-168853668 AAGGGCTGAGACTCTGAGAATGG + Intronic
984700512 4:182815726-182815748 AAGAGTAGAGACACGGAGAAGGG - Intergenic
985890261 5:2709931-2709953 TGGGGCAGAGAGGCTGAGAACGG - Intergenic
988077205 5:26367927-26367949 TGGGGTGGAGACACTGACAATGG - Intergenic
988312917 5:29584718-29584740 AAGTGTAGAGTCTCTGTGAACGG - Intergenic
988702773 5:33691946-33691968 TGGGGTAGGGACACTGAGAGGGG - Intronic
990866455 5:60385759-60385781 AGAGGTGGACATTCTGAGAAGGG - Intronic
991004119 5:61810971-61810993 AGGGTTCGAGACTCTGATGAAGG + Intergenic
991960358 5:72038159-72038181 ATGGGCAGAGACTCTGAGGTTGG - Intergenic
992960683 5:81954480-81954502 AAGAGTAGAGACACGGAGAAGGG - Intergenic
992998961 5:82360861-82360883 AGGGCTAGAGAGTTTGAGAGCGG + Intronic
993192563 5:84699688-84699710 AAGAGTAGAGACACGGAGAAGGG - Intergenic
993491477 5:88556648-88556670 GGTAGGAGAGACTCTGAGAAAGG - Intergenic
993836557 5:92825203-92825225 AAGAGTAGAGACACAGAGAAGGG - Intergenic
994428894 5:99630074-99630096 AGGGGTAGATTTTCTGAGATAGG - Intergenic
994556774 5:101316111-101316133 AAGAGTAGAGACACGGAGAAGGG - Intergenic
995769223 5:115651703-115651725 AAAGGTAGAGACACGGAGAAGGG - Intergenic
996156896 5:120113500-120113522 AAGGGTAGATAATCTGATAATGG + Intergenic
997637466 5:135424610-135424632 AGGGTTACTGACTCTGAAAAAGG + Intergenic
998693865 5:144615942-144615964 AAGGGTAGAGACACGGAGAAGGG + Intergenic
998760641 5:145428343-145428365 AGAGGTAGAGATTCTTACAATGG - Intergenic
999324196 5:150632978-150633000 AGGGGTAGGGACTCTGAGCAGGG - Intronic
1000380297 5:160622841-160622863 AGGGGTAGAGGGTCTCAGCATGG - Intronic
1000519564 5:162279883-162279905 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1001671055 5:173474296-173474318 GGGGGTAGATACCTTGAGAAGGG + Intergenic
1002067488 5:176659326-176659348 AGGGGTGGAGATACAGAGAAGGG + Intergenic
1002602813 5:180363704-180363726 AAGTGGAGAGACTCTGAGAGTGG + Intergenic
1004575073 6:16887161-16887183 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1007753664 6:44084808-44084830 AAGGGCAGAGACAGTGAGAAGGG + Intergenic
1010829841 6:80514838-80514860 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1010894686 6:81349601-81349623 AAGAGTAGAGACACAGAGAAGGG + Intergenic
1012066694 6:94558437-94558459 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1013616364 6:111846955-111846977 ACTTGTAGAGACTCTGAAAAAGG - Intronic
1014115502 6:117664223-117664245 AAGGGTAGAGACATGGAGAAGGG + Intergenic
1014718465 6:124891661-124891683 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1015266585 6:131296676-131296698 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1015271222 6:131340094-131340116 AAGAGTAGAGACACAGAGAAGGG - Intergenic
1015278001 6:131404031-131404053 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1016650442 6:146454907-146454929 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1016853113 6:148640992-148641014 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1017269654 6:152491387-152491409 AAAGGTAGAGACACAGAGAAGGG - Intronic
1018825324 6:167404500-167404522 AGGGGTAGATCCCCTGTGAATGG - Intergenic
1019504594 7:1384349-1384371 AGGGGTGCAGATTCTGAGGACGG + Intergenic
1020319012 7:6926756-6926778 AGGGGTGGAGCTTCTGGGAAAGG + Intergenic
1021660456 7:22914320-22914342 GAGGGTAGAGACACGGAGAAGGG - Intergenic
1021717188 7:23470744-23470766 TGGGAGAGGGACTCTGAGAAGGG + Intergenic
1022572939 7:31471545-31471567 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1022617862 7:31951087-31951109 AGAGGAAGAGACACTGGGAATGG - Intronic
1022854929 7:34304608-34304630 AGGGGTAGAGACACGGAGAGAGG + Intergenic
1023689500 7:42771800-42771822 AGAGGTAGTGACTCAGGGAATGG + Intergenic
1023949063 7:44826732-44826754 AGCTTTAGAAACTCTGAGAAAGG - Intergenic
1023987899 7:45108257-45108279 AGGGGAAGACTCTCTAAGAAGGG + Intronic
1025758237 7:64366377-64366399 AGGGGAAGAGAATCTGCAAATGG + Intergenic
1027158071 7:75782465-75782487 AAGGGTAGAGACATGGAGAAGGG - Intronic
1027354252 7:77340865-77340887 GAGGGTAGAGACACGGAGAAGGG - Intronic
1028463596 7:91123707-91123729 AGGGGTGGAGAGGCAGAGAAGGG - Intronic
1028590064 7:92484324-92484346 AAAGGTAGAGACACAGAGAAGGG + Intergenic
1030163775 7:106532940-106532962 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1031728083 7:125263409-125263431 AAGAGTAGAGACACAGAGAAGGG + Intergenic
1031954400 7:127927617-127927639 ACTGTTAGAGACACTGAGAATGG + Intronic
1032730535 7:134637834-134637856 AGGTTTAAAGACTCTGATAATGG - Intergenic
1033084555 7:138330200-138330222 AAGGGTAGAGACACTGAGAAGGG - Intergenic
1033089608 7:138373149-138373171 AGCCGTATAGACGCTGAGAATGG + Intergenic
1033544684 7:142389278-142389300 AGGGGTGGGAAATCTGAGAATGG - Intergenic
1033909615 7:146247866-146247888 AAGAGTAGAGACACGGAGAAGGG + Intronic
1034333917 7:150308186-150308208 GGGGGTAGAGACTCGAAGAGAGG - Intronic
1034575617 7:151994576-151994598 ACGGGCAGAGGCTCTGAGACGGG - Intronic
1036549505 8:9804133-9804155 AAGGGTGGAGACACAGAGAAGGG - Intergenic
1036558631 8:9883248-9883270 AGGTGTAGATACTTTGGGAATGG + Intergenic
1039076624 8:33695655-33695677 AGGGATAGAGAGGCAGAGAAGGG + Intergenic
1040839244 8:51767247-51767269 AGGGGGAGAGACAGAGAGAAAGG - Intronic
1041917694 8:63152841-63152863 AAGGGTAGAGACATGGAGAAGGG + Intergenic
1042435068 8:68754684-68754706 AGAGGTAGAGACTTTTAGAGTGG - Intronic
1042594139 8:70427663-70427685 AGGGGCAGAGGCTGGGAGAAGGG - Intergenic
1043353829 8:79390597-79390619 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1043720693 8:83544592-83544614 AAAGGTAGAGACACAGAGAAGGG - Intergenic
1044148661 8:88746706-88746728 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1044176257 8:89126958-89126980 AGTGGTAGGGACTCTGAGGATGG + Intergenic
1044258771 8:90094698-90094720 AAGAGTAGAGACACGGAGAAGGG + Intronic
1044416934 8:91949222-91949244 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1044921768 8:97176072-97176094 AGGGGTAGAGACACTGAAGAAGG - Intergenic
1045644633 8:104287162-104287184 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1045965507 8:108020174-108020196 AGGGGGTGAGACTCTGAGATGGG - Intronic
1046511930 8:115213452-115213474 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1046559121 8:115815812-115815834 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1047829691 8:128616397-128616419 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1048585570 8:135771638-135771660 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1050106246 9:2169590-2169612 TGGGGCAGTGACTCCGAGAAGGG + Intronic
1050117392 9:2276594-2276616 AGGGGTAGAGACGGAGAGAAGGG - Intergenic
1050258263 9:3815690-3815712 ATGAGTAGAGACACGGAGAAGGG + Intergenic
1051052467 9:12949524-12949546 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1051739875 9:20240881-20240903 AGGGGCAGAGACTCTGTAACTGG - Intergenic
1051849443 9:21490193-21490215 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1051953558 9:22663042-22663064 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1052641340 9:31168657-31168679 AGAGAGAGAGACTCTGAAAATGG - Intergenic
1056437388 9:86587802-86587824 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1056777566 9:89524828-89524850 AGAGATAGAGACACAGAGAAAGG + Intergenic
1056833913 9:89939216-89939238 AGAGGCAGAGACTGAGAGAAAGG - Intergenic
1056882823 9:90413779-90413801 AAGAGTAGAGACACAGAGAAGGG - Intergenic
1057683816 9:97215832-97215854 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1057812740 9:98270352-98270374 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1058612248 9:106789394-106789416 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1059345437 9:113625057-113625079 AGGGGTGGAGAGTCAGAGAATGG - Intergenic
1059574470 9:115474581-115474603 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1059963549 9:119591279-119591301 AGGCATAGAGACTCTGAGAATGG + Intergenic
1061372827 9:130207402-130207424 AGGGGCAGAGGCTCTGAGGTGGG - Intronic
1061838884 9:133346495-133346517 AGGGGAGCAGAGTCTGAGAAGGG - Intronic
1062421723 9:136485634-136485656 AGGGGCAGAGACTTGGAGAATGG - Exonic
1062542632 9:137048415-137048437 AGGGGCAGAGACGCTGAGGGTGG + Exonic
1062731860 9:138114341-138114363 AGGAGTTGAGATTCGGAGAAGGG - Intronic
1185858709 X:3558803-3558825 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1185990905 X:4892808-4892830 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1186162687 X:6794159-6794181 ATGGGGACACACTCTGAGAAAGG + Intergenic
1190286183 X:48962713-48962735 AGGGGTAGGGATGCTGATAATGG + Exonic
1190951335 X:55146595-55146617 AAGGGTAGAGAATGTGTGAAGGG - Intronic
1191014354 X:55792814-55792836 AAAGGTAGAGACACAGAGAAGGG + Intergenic
1191958723 X:66675468-66675490 AGAAGTTGAGACTCAGAGAAAGG + Intergenic
1193536900 X:82727725-82727747 AAGGGTAGAGACACCGAGAAGGG - Intergenic
1193740506 X:85210991-85211013 AGGGGTAGAGATTCTTAGATTGG - Intergenic
1194351135 X:92825706-92825728 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1194430518 X:93798254-93798276 AGGGGTAGATGATATGAGAAAGG + Intergenic
1194460473 X:94161097-94161119 GAGGGTAGAGACTGTGAGAAGGG - Intergenic
1195908830 X:109869705-109869727 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1196533683 X:116816954-116816976 AAGAGTAGAGACACGGAGAAGGG + Intergenic
1196572351 X:117280381-117280403 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1197830431 X:130636491-130636513 AGGAGTAGTGCCTCTGAGTAAGG - Intronic
1198153671 X:133935559-133935581 AGCTCTAGAGACTCTGAAAAGGG - Intronic
1198167156 X:134069204-134069226 AAGGGAAGAGACACAGAGAAAGG + Intergenic
1198983906 X:142428062-142428084 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1199559057 X:149143471-149143493 AGGGGTATTGATTCTGAGAGAGG - Intergenic
1199872177 X:151909187-151909209 AGGGCTAGAGAATATGATAAAGG + Intergenic
1200659461 Y:5942386-5942408 AAGAGTAGAGACACGGAGAAGGG - Intergenic
1200812655 Y:7501564-7501586 AAGGGTAGAGACACAGAAAAGGG - Intergenic