ID: 909551967

View in Genome Browser
Species Human (GRCh38)
Location 1:76907972-76907994
Sequence CCACCTGCAGAATCTCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909551967 Original CRISPR CCACCTGCAGAATCTCTGGA AGG Intronic
900746985 1:4367198-4367220 TCACCTGCAGGATCTCTGTGTGG + Intergenic
901680853 1:10912026-10912048 ACTCCTGCAGGATCTCTGGTGGG + Intergenic
901908298 1:12433547-12433569 CCAGCTGCAGAGTCACTGGCGGG - Intronic
903886170 1:26542342-26542364 CCACCCGCAGAGACTCTGCAAGG + Intronic
903960931 1:27057434-27057456 CCACGGGCAGCATCTCAGGAAGG + Intergenic
904016089 1:27422017-27422039 CCCCCTCCAGAATAGCTGGATGG - Intronic
904057385 1:27680374-27680396 CCTCCTGGAGAATCTCTGCTAGG - Intergenic
904313587 1:29645396-29645418 GCACCTGCTGAATCTATAGATGG - Intergenic
904350414 1:29901770-29901792 CAGCCTGCAGGATTTCTGGAAGG + Intergenic
904540411 1:31228951-31228973 ACCCCTGCAGAGCCTCTGGAGGG + Intronic
905396628 1:37670510-37670532 CCACCCCCGGACTCTCTGGAAGG + Intergenic
905537910 1:38738020-38738042 GCAGCTTCAGAATCTCAGGACGG + Intergenic
908435070 1:64097809-64097831 CAAGCTCCAGAACCTCTGGAGGG + Intronic
908990415 1:70081017-70081039 GCAGCTGCAGAATCTGTTGAGGG + Intronic
909551967 1:76907972-76907994 CCACCTGCAGAATCTCTGGAAGG + Intronic
912475035 1:109929583-109929605 CCTCCTGGAGAAGCTCTGGCAGG - Exonic
913780472 1:122379840-122379862 CCACTTGCAGAATCTGCAGAAGG - Intergenic
914902726 1:151720257-151720279 CCACCACCAGCTTCTCTGGAGGG + Intronic
915822115 1:159035221-159035243 ACACCTGCATAAACTATGGAGGG - Intronic
921149114 1:212385768-212385790 CCACCTGCAGAATCACTGGGAGG + Intronic
922301788 1:224308091-224308113 CCTCCTTCAGAATCTTTGGCAGG + Exonic
922558434 1:226549894-226549916 CCTCCTGCACCATCTCTGTAAGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063299770 10:4841041-4841063 CCAGCTGGAGAGTCTCTAGAAGG + Intronic
1063331175 10:5160971-5160993 CCACCTCCTGAAACTCTTGAAGG - Intergenic
1063381548 10:5589112-5589134 CCACCTGCAGGGCCTCTGGCTGG + Intergenic
1063951841 10:11230544-11230566 CCACCTTCAGAATGTCTGGAAGG - Intronic
1064847744 10:19674475-19674497 CCAACTGCAGAATCTGTGAGGGG - Intronic
1067558382 10:47287779-47287801 CAGCCTGGAGAATATCTGGATGG - Intergenic
1069716207 10:70523041-70523063 CCACCTCCAAAATATCTAGAGGG - Intronic
1069807743 10:71136550-71136572 CCACCTCCAGACTCTGAGGAAGG + Intergenic
1070512201 10:77171717-77171739 AAACCTGGAGAATCTCTGAAAGG - Intronic
1070983153 10:80666347-80666369 CAACCTGCAGACCCCCTGGAGGG + Intergenic
1075901837 10:126049437-126049459 CCACATTTAGCATCTCTGGAAGG + Exonic
1076481516 10:130788164-130788186 CAACCTGGAGAATCCCTGGTAGG - Intergenic
1076603577 10:131675067-131675089 CCACTTGCAGGATCTCTTAAAGG - Intergenic
1077228414 11:1448238-1448260 CCACCTGCAGGAGCTGAGGAGGG + Intronic
1078929825 11:15904483-15904505 AAACTTGCAGAATCTCTAGAGGG - Intergenic
1079015789 11:16867625-16867647 CCTCCTGGGGAAGCTCTGGAGGG - Intronic
1082548042 11:54358103-54358125 CCACTTGCAGATTCTATGAAAGG - Intergenic
1083274180 11:61587624-61587646 CCAGCTGCAGAATTCCTGGGGGG + Intergenic
1083302441 11:61746044-61746066 CCACCTGCAGCCTCCCTGGGTGG + Exonic
1083811393 11:65108698-65108720 CCACCTGCAGGGTCTCCGGGCGG + Exonic
1084090801 11:66878433-66878455 TCACCTCCAGAGCCTCTGGAAGG + Intronic
1084289251 11:68151368-68151390 CCAGCTGCACAATCTCAGGCAGG + Intergenic
1085961577 11:81468547-81468569 CCACTTGCAGCATCACTTGAAGG + Intergenic
1086828863 11:91534541-91534563 CCTCATGGAGAATCTCTGGTAGG + Intergenic
1087655046 11:100912408-100912430 TCAGTTCCAGAATCTCTGGAAGG + Intronic
1088519919 11:110685463-110685485 CCACCTCCAGCAGCTCTGAATGG + Intronic
1088676803 11:112202148-112202170 CCAGTTACAGAATCTCAGGAAGG + Exonic
1091244391 11:134079474-134079496 CCACCCACTGCATCTCTGGAAGG + Intronic
1094393349 12:29977385-29977407 CCAACTGCAGAACCTCTGGGTGG + Intergenic
1097038278 12:56138394-56138416 TCACCTGCAGCACCTGTGGAGGG - Exonic
1097476100 12:60058061-60058083 CCACCTGGAGAACCTCTGCTAGG + Intergenic
1098574549 12:72026450-72026472 CCACTTGCAGCAACTCTGGGAGG + Intronic
1099990029 12:89710454-89710476 CAACTTGCAAAATCTCTTGAAGG - Intergenic
1101572097 12:105963013-105963035 TCACCTGCTGAGCCTCTGGAAGG - Intergenic
1103945206 12:124522404-124522426 CCCCCTGCAGAGTCTTTGGAGGG - Intronic
1104914608 12:132258154-132258176 CCAACTGCAGTATCTCTGAAGGG + Intronic
1105420299 13:20246424-20246446 CCATCTGCAGTAGCTCTGTAGGG - Intergenic
1106133302 13:26956947-26956969 CCACGTGGAGAATTTCGGGAAGG - Intergenic
1107026060 13:35802884-35802906 CCAGCTGCAGGCTCTCTGGGTGG - Intronic
1108164626 13:47679116-47679138 CCAACTGGAGCATCTCAGGAAGG + Intergenic
1109075088 13:57824063-57824085 CCACCTGCAGCATGGCTGGGGGG - Intergenic
1112791249 13:103004637-103004659 CAACCTGCAGAAAGTCTTGAAGG + Intergenic
1113760227 13:112841422-112841444 GCACCTGAAGCATCCCTGGACGG - Intronic
1113760269 13:112841620-112841642 GCACCTGAAGCATCCCTGGACGG - Intronic
1116508520 14:45715160-45715182 CCACCTACAGCACCTATGGAGGG - Intergenic
1119539766 14:75430165-75430187 CAACCTGCAGAATCCCTGGCAGG + Intronic
1121685262 14:95830962-95830984 CCACTGGCAGGAACTCTGGAGGG - Intergenic
1124338916 15:28877168-28877190 CTTCCTGCAGAGTCTCTGGCTGG + Intergenic
1124426417 15:29567119-29567141 CCACCTGCTGACTCACTGGCTGG + Intronic
1127543980 15:59972449-59972471 GCCCCTGCAGAGCCTCTGGAGGG + Intergenic
1127578639 15:60316554-60316576 CCATTTGCAGCATCCCTGGAAGG - Intergenic
1129193062 15:73948617-73948639 CCACCTGCTGACTTTCTGCAGGG - Intronic
1129850440 15:78790738-78790760 CCACTTGCAGAAGCTCTTCAGGG + Exonic
1130251827 15:82304784-82304806 CCACTTGCAGAAGCTCTTCAGGG - Intergenic
1130911921 15:88276780-88276802 CCCCTTGAAGACTCTCTGGAAGG + Intergenic
1131263491 15:90902557-90902579 CCAGCTGCGGAACCTCAGGAGGG - Intronic
1132249566 15:100325108-100325130 CCACCTCCAGCCACTCTGGAGGG - Intronic
1133247009 16:4455645-4455667 CCACCCGCAGAGCCTCTGGACGG + Exonic
1138515829 16:57535217-57535239 CCAGCTGCAGGACCTCTGGGGGG + Intronic
1140200801 16:72893214-72893236 CTACCTCCAAAATCTCTTGATGG - Intronic
1140401820 16:74678010-74678032 TCACTTGCAGAAACACTGGAAGG + Intronic
1144235220 17:13254206-13254228 CCTCCTGCAGAAAGTCTGCATGG + Intergenic
1145092883 17:20000447-20000469 CCACCTGCAGCTTCTCAGGCAGG - Intergenic
1145248214 17:21283709-21283731 CCATCTGCATAATGGCTGGATGG - Intergenic
1146165475 17:30584993-30585015 CCACCTGCAGCTTCTCAGGCAGG - Intergenic
1146938377 17:36826472-36826494 CCAACTGCAGCATCAATGGAGGG - Intergenic
1147539161 17:41342534-41342556 CCCCCTGCAGAGTCTATGAACGG - Intergenic
1147920698 17:43915213-43915235 CAAGGTGCAGAATCTCTGGGAGG + Intergenic
1148405842 17:47414840-47414862 CCACCTCCATATTATCTGGAAGG - Exonic
1149700129 17:58648334-58648356 CTACCTGCAGCCTCTCTGGTTGG + Intronic
1152334041 17:79690271-79690293 CCACCACCAGAATCTGTGCATGG + Intergenic
1154399502 18:14023115-14023137 CCACCTTCAAAATCTATTGAAGG - Intergenic
1155331909 18:24727469-24727491 ACACCTGCAGGCTCTCTGGCGGG + Intergenic
1155991171 18:32280874-32280896 CCACCTTCTGACTCTTTGGAGGG + Intronic
1157643091 18:49237759-49237781 TTACATGCAGAAACTCTGGAAGG - Intronic
1158679190 18:59551365-59551387 GAACCGGAAGAATCTCTGGATGG + Intronic
1158702466 18:59760812-59760834 CTACATGTAGAATCGCTGGAAGG + Intergenic
1160014884 18:75133086-75133108 CCTCCTGCAGACTCCATGGATGG - Intergenic
1160041970 18:75353584-75353606 CCTCCTGGAGAACCTGTGGAAGG + Intergenic
1161057556 19:2198315-2198337 GCACCTGCAGAGGCTCAGGATGG + Intronic
1162851379 19:13433660-13433682 CCAACCTCAGAATCTCTGGGAGG + Intronic
1164362142 19:27525257-27525279 CAACCTGCTGAATCTAAGGAAGG - Intergenic
1164363662 19:27548242-27548264 CCTTTTGCAGAATCTGTGGAGGG + Intergenic
925041999 2:739772-739794 CCACCTGCAGGGTCCGTGGAAGG - Intergenic
927083677 2:19654198-19654220 GCCCATGCAGAATCACTGGAGGG - Intergenic
928594291 2:32845667-32845689 CCCCATGGAGAATCTCTGGTAGG + Intergenic
929744874 2:44646464-44646486 TCAGCTTCAGAATCACTGGATGG - Intronic
933650166 2:84844012-84844034 GCACCTCCAGTCTCTCTGGAAGG + Intronic
933811284 2:86034285-86034307 CAACCTGCAGCATCTCCAGAAGG + Intronic
934470773 2:94531612-94531634 CCACTTGCAGATTCTCCTGAAGG + Intergenic
934984520 2:98874640-98874662 GGGACTGCAGAATCTCTGGAAGG + Intronic
935433643 2:103004528-103004550 CCACCTGCAGCCTCTCTTGGAGG + Intergenic
936373427 2:111921539-111921561 CCACCTGCAGAAGGGCTGTAGGG + Intronic
937299541 2:120830668-120830690 CCACCTGCACATTCTCCAGAGGG - Intronic
938090403 2:128427565-128427587 CGTCCTGCAGAGTCTCTGGGGGG + Intergenic
940787730 2:158000300-158000322 CCAGCTGAAGAATCTCTGCAAGG + Intronic
943126679 2:183803216-183803238 CCACCTCCAGAATTTCTGTTTGG + Intergenic
943345211 2:186730750-186730772 CCAGCTTCAGAATGTCAGGAGGG + Intronic
943565598 2:189512587-189512609 CCATCTGGAGAATCTCTGACAGG - Intergenic
945761928 2:213924239-213924261 GCCCCTGCAAAATGTCTGGATGG + Intronic
946289546 2:218733706-218733728 CCACCTGCAGCTTCTGAGGAGGG + Intronic
946534112 2:220607844-220607866 CCTCATGGAGAACCTCTGGAAGG - Intergenic
948257677 2:236579603-236579625 CCACCTGCTGCATTTCAGGAGGG - Intronic
948922663 2:241073059-241073081 CCTCCTGCTGACCCTCTGGAGGG - Intronic
948945063 2:241215208-241215230 CCAGCCGCAGCATCTCTGAACGG - Intronic
1168818683 20:758924-758946 CCATTTGTATAATCTCTGGAAGG + Intergenic
1169357208 20:4917364-4917386 CCCCCTGAAGATTGTCTGGATGG + Intronic
1171214333 20:23341449-23341471 ACACCTGAAGAATGTCTAGATGG - Intergenic
1171739365 20:28860947-28860969 CCACTTGCAGATTCTATGAAAGG + Intergenic
1173183673 20:40822784-40822806 GCACCTGCAAAATCTCAAGAAGG + Intergenic
1173472563 20:43335131-43335153 CCATCTCCAGAATCTCTGCCTGG - Intergenic
1174105781 20:48161311-48161333 CCACCTGCCTTCTCTCTGGAGGG - Intergenic
1175318535 20:58069405-58069427 CAGCCTGAAGAAGCTCTGGAGGG - Intergenic
1175996445 20:62814206-62814228 CCACCTTCAGAGGCTCTGGGAGG - Intergenic
1176762611 21:12971059-12971081 CCACTTGCAGATTCTCCTGAAGG + Intergenic
1178099570 21:29253114-29253136 CCACATGGAGAATCTCTGCCAGG - Intronic
1179303321 21:40132522-40132544 ACACCTGCACATTCCCTGGAAGG + Intronic
1180073387 21:45449759-45449781 CCACCTGCAGATTCAGTGGCTGG - Intronic
1180170555 21:46055988-46056010 CTGCCTGCTGATTCTCTGGAAGG + Intergenic
1180702261 22:17787919-17787941 CCACATGCAGCTTCCCTGGAGGG - Exonic
1180798175 22:18617882-18617904 CCTCCTGCAGGCTCTCAGGATGG - Intergenic
1180877942 22:19183796-19183818 CCACCTCCGGAGGCTCTGGAGGG + Intronic
1181223544 22:21377384-21377406 CCTCCTGCAGGCTCTCAGGATGG + Intergenic
1181255199 22:21558238-21558260 CCTCCTGCAGGCTCTCAGGATGG - Intronic
1184471601 22:44699144-44699166 CCACCTCCGGAATTTCTGGCTGG + Intronic
949481865 3:4501901-4501923 CCATCAGCAGAACTTCTGGATGG + Intronic
950615231 3:14152717-14152739 CCAGCTGCAGACTATCAGGATGG + Intronic
956380978 3:68664114-68664136 GCAGCTACAGAATCTCTGGCTGG - Intergenic
957878823 3:86183827-86183849 CCATCTGCAGAAGCTCTTGAAGG - Intergenic
958600355 3:96289028-96289050 TCACATGCAGAATCTCTGCTAGG + Intergenic
959176346 3:102916644-102916666 CCACCTGCAAAAGCTCTCAAAGG + Intergenic
959558375 3:107750031-107750053 CATCCTGCAGAATCACAGGATGG - Intronic
968626221 4:1627814-1627836 CCCCCTGCATGACCTCTGGAGGG - Intronic
969150387 4:5164214-5164236 CCACCTTCAGAGCCTCTAGAAGG - Intronic
969390909 4:6890778-6890800 CCAACTGCAAAATTTGTGGATGG + Intergenic
969659485 4:8518110-8518132 CTTCCTGCACAAGCTCTGGAAGG + Intergenic
971221896 4:24716631-24716653 GCCCATCCAGAATCTCTGGATGG - Intergenic
971515463 4:27481004-27481026 CAAAATGCTGAATCTCTGGAAGG + Intergenic
972336359 4:38110254-38110276 CCACCTGCAAGATCTCTTGAGGG + Intronic
972761953 4:42115143-42115165 CAACATTCAGAATCTGTGGATGG + Exonic
973405211 4:49724388-49724410 CCACCTGCAGATTCTACGAAAGG - Intergenic
973406668 4:49748214-49748236 CCACCTGCAGATTCTACGAAAGG - Intergenic
973411367 4:49825593-49825615 CCACCTGCAGATTCTACGAAAGG - Intergenic
973418941 4:49950702-49950724 CCACCTGCAGATTCTTCAGAAGG - Intergenic
973445596 4:50391607-50391629 CCACCTGCAGATTCTATAAAAGG - Intergenic
973453522 4:50523018-50523040 CCACCTGCAGATTCTACGAAAGG - Intergenic
973475196 4:50880060-50880082 CCACCTGCAGATTCTACGAAAGG - Intergenic
973484191 4:51029173-51029195 CCACCTGCAGATTCTACGAAAGG - Intergenic
973485867 4:51056554-51056576 CCACCTGCAGATTCTACAGAGGG - Intergenic
973491117 4:51143130-51143152 CCACCTGCAGATTCTACGAAAGG - Intergenic
974996780 4:69170562-69170584 AGACCTGCAGAATCTCTAGCTGG - Intronic
975008285 4:69318220-69318242 AGACCTGCAGAATCTCTAGCTGG + Intronic
975009753 4:69335525-69335547 AGACCTGCAGAATCTCTAGCTGG - Intronic
980877489 4:138676640-138676662 CCACATTCAGTACCTCTGGAGGG - Intergenic
985776168 5:1843599-1843621 TGACCGGCAGGATCTCTGGAGGG - Intergenic
986745667 5:10742587-10742609 CCACCTGAAGAATCTCCTTATGG - Intronic
988926386 5:35994839-35994861 CCCCCTTCAGAAACTCCGGATGG + Intergenic
989441289 5:41475055-41475077 CCACCTACAGCACCTTTGGAGGG - Intronic
989920480 5:49795674-49795696 CCACCTGCAGATTCTCCAAAAGG - Intergenic
989924833 5:49859733-49859755 CCACCTGCAGATTCTCCAAAAGG - Intergenic
989930168 5:49938929-49938951 CCACCTGCAGATTCTCCAAAAGG - Intergenic
989933303 5:49985433-49985455 CCACCTGCAGATTCTCCCAAAGG - Intergenic
989934495 5:50003151-50003173 CCACCTGCAGATTCTCCAAAAGG - Intergenic
989944486 5:50203542-50203564 CCACATGCAGAATCTACAGAAGG + Intergenic
990194734 5:53301848-53301870 GGCCCTGCAGGATCTCTGGAAGG + Intergenic
992906351 5:81349593-81349615 CCACCTTCAGGGTCTCTTGAAGG + Intronic
998391221 5:141788237-141788259 CCTGCTGCAGATCCTCTGGAGGG + Intergenic
1000386541 5:160679747-160679769 CCAGCTGCTGAAACTGTGGAGGG + Intronic
1002191111 5:177478124-177478146 CCACCTGGAGAGTCTGAGGATGG + Intergenic
1003025815 6:2555032-2555054 TCACTTGCAGCCTCTCTGGAAGG + Intergenic
1003487079 6:6588994-6589016 CCACCTGCAGCAGGTCTGGGAGG + Intronic
1005220298 6:23579049-23579071 CCACCAGCTGGATCTCTGAAGGG - Intergenic
1005685346 6:28248351-28248373 CCACGTGCAGAATCGTTGGTAGG + Intronic
1007948055 6:45843665-45843687 CCACCTTCAGATTCTTAGGATGG + Intergenic
1013338188 6:109186711-109186733 CCTCCTGCATAATCTCTAGGTGG + Intergenic
1013788686 6:113811835-113811857 CCACCTGCAGAAGCTGGAGAAGG - Intergenic
1015782569 6:136884431-136884453 CTACCTTTAGATTCTCTGGATGG + Intronic
1016360503 6:143262398-143262420 CCAGCTGCAGAATCAGTGTAAGG - Intronic
1016613765 6:146024190-146024212 CCTCATAGAGAATCTCTGGAAGG + Intergenic
1016622737 6:146131553-146131575 CCACTTGCAGAGGCTCTAGAAGG + Intronic
1017047516 6:150361108-150361130 CCAGCATCAGAATCACTGGAGGG + Intergenic
1018194028 6:161338990-161339012 CCACCTGGAGCATCACTGGTGGG + Intergenic
1018227977 6:161648085-161648107 CCACCTGAATAATCCCTGGCTGG - Intronic
1018763119 6:166907802-166907824 GCACCTGCGGAACCTCTGGCAGG + Intronic
1018931293 6:168242016-168242038 CCCCCTGCAGGATCACTGGAGGG - Intergenic
1019128758 6:169858876-169858898 AGACCTGGAGAATCTCTGCATGG + Intergenic
1019874317 7:3795362-3795384 CCTCCTGCAGTATTGCTGGAAGG + Intronic
1021209530 7:17830035-17830057 CCCCCTGCAGAATCTTTTAATGG - Exonic
1021850635 7:24804754-24804776 ACACATGAAGAATCTCTAGAAGG - Intronic
1022906741 7:34865283-34865305 ACACCCACAAAATCTCTGGAAGG + Intronic
1023564695 7:41512313-41512335 CCACCAGCAACATCTCAGGAAGG + Intergenic
1024047635 7:45596089-45596111 CCACCTCTAGGCTCTCTGGATGG - Intronic
1024396204 7:48870443-48870465 CCACCTGCACCATCTCTTGCTGG - Intergenic
1024402847 7:48944959-48944981 CCACCAGCAGATTCAATGGAGGG + Intergenic
1025499598 7:61268891-61268913 CCACTTGCAGAATCTGTAAAAGG - Intergenic
1025514446 7:61615116-61615138 CCACTTGCAGAATCTGTAAAAGG - Intergenic
1025538795 7:62043956-62043978 CCACTTGCAGAATCTGTAAAAGG - Intergenic
1026819424 7:73536986-73537008 TCTGCTCCAGAATCTCTGGACGG - Exonic
1027414303 7:77958687-77958709 CCACTTCCAGCCTCTCTGGAGGG + Intergenic
1027599633 7:80223217-80223239 CCAACTGCAGTGTCTATGGAGGG + Intergenic
1028275123 7:88846253-88846275 CCACCCGCAGAGTCACTGGTAGG + Intronic
1028514395 7:91660378-91660400 GCAGCTTCTGAATCTCTGGAGGG + Intergenic
1031112249 7:117624936-117624958 CTACCTCCAGTACCTCTGGAAGG - Intronic
1034718348 7:153264341-153264363 CCACATGGAGAATCTCTGCTAGG - Intergenic
1035354679 7:158270068-158270090 CCTCCTGCAAAAGCTCTGGTTGG - Intronic
1038317881 8:26502929-26502951 CCACCAGCTGAATCTTTGAATGG - Intronic
1038765934 8:30427732-30427754 CCACTTGTATAAACTCTGGATGG - Intronic
1039968065 8:42298278-42298300 CCACCTGCAGAATCCAGGAAAGG - Intronic
1041632701 8:60105996-60106018 CCACTTGAAGAAGCTGTGGAGGG - Intergenic
1042581498 8:70284203-70284225 TCATCCTCAGAATCTCTGGACGG + Intronic
1044169489 8:89031480-89031502 CAACCAGCAAAATCCCTGGATGG + Intergenic
1045000962 8:97877680-97877702 CCACCTGCAGAAATTCAGGAAGG + Intronic
1046271582 8:111904253-111904275 TCACACCCAGAATCTCTGGATGG - Intergenic
1047792927 8:128223249-128223271 CCAGCTGCAAATTATCTGGATGG + Intergenic
1048012491 8:130469472-130469494 CCAACTGCAGCCTCCCTGGAAGG - Intergenic
1048231099 8:132642853-132642875 CCACCTGAAGATTCTCTGAACGG + Intronic
1050038658 9:1464168-1464190 CCACCAGCAGATTCTTTGGAAGG + Intergenic
1052200748 9:25776540-25776562 CCACCTGCAATATCTATGAAGGG + Intergenic
1055362579 9:75509452-75509474 CCAGCTTCAAAATCTTTGGAAGG - Intergenic
1056057661 9:82844324-82844346 TCACATGGAGAATCTCTGAAGGG - Intergenic
1057043726 9:91867320-91867342 CCACCTCCACCATCACTGGATGG - Intronic
1057543403 9:95998233-95998255 CCATCTACAGAACCTTTGGAGGG + Intronic
1203353675 Un_KI270442v1:109429-109451 CCACTTGCAGAATCTACGTAGGG - Intergenic
1203415851 Un_KI270588v1:905-927 CCACTTGCAGATTCTATGAAAGG - Intergenic
1203685536 Un_KI270757v1:51763-51785 CCACTTGCAGATTCTATGAAAGG - Intergenic
1186345597 X:8689092-8689114 CCACCTGCATTATCACTAGAAGG + Intronic
1186826637 X:13346770-13346792 CCAACTGCACATTCTCTAGAAGG + Intergenic
1188137408 X:26505923-26505945 CCACCAGCATACTCTGTGGATGG + Intergenic
1193485209 X:82078729-82078751 CCTCATGGAGAATCTCTGCAAGG - Intergenic
1195325470 X:103754791-103754813 CCTCCTGCAGATTCATTGGAGGG + Intergenic
1200887269 Y:8281978-8282000 CCAGCTGCAGAAGCTCAGGTAGG - Intergenic
1201421325 Y:13802890-13802912 CCACCTGCATTATCACTAGAAGG - Intergenic