ID: 909559511

View in Genome Browser
Species Human (GRCh38)
Location 1:76994030-76994052
Sequence ATAATGACATTGTAGTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909559511_909559512 3 Left 909559511 1:76994030-76994052 CCAAACAACTACAATGTCATTAT No data
Right 909559512 1:76994056-76994078 TATATTTTTCTTATCAGAGAAGG 0: 1
1: 0
2: 10
3: 248
4: 3916
909559511_909559513 10 Left 909559511 1:76994030-76994052 CCAAACAACTACAATGTCATTAT No data
Right 909559513 1:76994063-76994085 TTCTTATCAGAGAAGGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909559511 Original CRISPR ATAATGACATTGTAGTTGTT TGG (reversed) Intronic
No off target data available for this crispr