ID: 909562347

View in Genome Browser
Species Human (GRCh38)
Location 1:77020783-77020805
Sequence TTCTGAAATTTGCAGTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909562344_909562347 18 Left 909562344 1:77020742-77020764 CCCCACACTTGGTAATTGTTCAT 0: 1
1: 0
2: 0
3: 10
4: 210
Right 909562347 1:77020783-77020805 TTCTGAAATTTGCAGTTAGATGG No data
909562345_909562347 17 Left 909562345 1:77020743-77020765 CCCACACTTGGTAATTGTTCATT No data
Right 909562347 1:77020783-77020805 TTCTGAAATTTGCAGTTAGATGG No data
909562346_909562347 16 Left 909562346 1:77020744-77020766 CCACACTTGGTAATTGTTCATTA 0: 1
1: 0
2: 1
3: 20
4: 243
Right 909562347 1:77020783-77020805 TTCTGAAATTTGCAGTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909562347 Original CRISPR TTCTGAAATTTGCAGTTAGA TGG Intronic
No off target data available for this crispr