ID: 909564270

View in Genome Browser
Species Human (GRCh38)
Location 1:77037626-77037648
Sequence GCAAATAGTAAGATCTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909564269_909564270 -7 Left 909564269 1:77037610-77037632 CCAAAAGCAATAAGAAGCAAATA No data
Right 909564270 1:77037626-77037648 GCAAATAGTAAGATCTAAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909564270 Original CRISPR GCAAATAGTAAGATCTAAGC AGG Intronic
906946549 1:50299559-50299581 TCAAATAGTATTATCAAAGCAGG - Intergenic
908971171 1:69833399-69833421 GCAAATAGGAAGATGTAGACAGG + Intronic
909564270 1:77037626-77037648 GCAAATAGTAAGATCTAAGCAGG + Intronic
910336938 1:86143969-86143991 GCAATTTGTAACATCTAATCAGG - Intronic
911625362 1:100117817-100117839 GCAAATATTAAGAATTAAGAAGG + Intronic
918686421 1:187421466-187421488 ACAAATATTCAGATCTCAGCAGG - Intergenic
920427763 1:205891912-205891934 TTAAATTGTAAGAACTAAGCAGG - Intergenic
922869355 1:228888917-228888939 GAAAATAAGAAGTTCTAAGCTGG + Intergenic
1063820455 10:9829077-9829099 GCTAATACTAAAATCTGAGCAGG + Intergenic
1071456213 10:85853353-85853375 GCAAGTAATAAGCTCTCAGCAGG - Intronic
1074621581 10:115130194-115130216 GCAAAAAGTAAGCTCTAGGTGGG - Intronic
1082264258 11:50102698-50102720 TTAAAAAGTAAGTTCTAAGCTGG - Intergenic
1087305184 11:96480920-96480942 GCACATTGTAGGATCTTAGCAGG - Intronic
1092702476 12:11247589-11247611 GCAATTAGTAAAATCTAACATGG - Intergenic
1093295849 12:17390681-17390703 TCAAAAAGTAAGATATCAGCTGG + Intergenic
1094058793 12:26291920-26291942 GCAAATGGGAAGATCGAAACAGG + Intronic
1094740032 12:33278607-33278629 TCAAAGAGTAAGATATAGGCAGG - Intergenic
1098175064 12:67781650-67781672 GCAGATAGTCAGATTTAACCAGG + Intergenic
1101223731 12:102666950-102666972 TTAAATTGTAAGAACTAAGCAGG + Intergenic
1107281234 13:38737869-38737891 GGAAATGGTATGATGTAAGCTGG + Intronic
1110136664 13:72075853-72075875 GAAAAGAGAAAGATATAAGCAGG - Intergenic
1115364310 14:32540009-32540031 ACAAAAAGAAAGATCTAAGAAGG + Intronic
1119992748 14:79217594-79217616 GGAAATAGTAATATCTAGGCAGG + Intronic
1120083520 14:80242007-80242029 GCAAATAGTAGGTTGTAACCTGG - Intronic
1123429264 15:20201111-20201133 GTAAATAGAAAGTTCTGAGCAGG - Intergenic
1124591573 15:31058555-31058577 TTAAAGAGTAAGATGTAAGCAGG + Intronic
1126251666 15:46574730-46574752 CCAAATACTAAGAACTGAGCAGG - Intergenic
1133885296 16:9821954-9821976 ACAAATAGAAAGATCCAAGAAGG - Intronic
1135880914 16:26255649-26255671 TCAAATAGTATGATGTAGGCAGG + Intergenic
1137465833 16:48708211-48708233 GGAAATAGGAAGAGCTAAGGAGG - Intergenic
1138815706 16:60200629-60200651 GCTAAAAGTAAGATCCAAGCTGG + Intergenic
1139444649 16:66989506-66989528 GCAAATAGTGAGACCTAGCCTGG + Intronic
1140800263 16:78480950-78480972 GCAAATAGTAAGAAAAGAGCAGG + Intronic
1140965712 16:79964091-79964113 GCCCATAGTCAGATCTAACCTGG - Intergenic
1147679328 17:42230298-42230320 GCAAATAGCAGCATCAAAGCTGG + Intronic
1147715670 17:42506397-42506419 GCAAATAATTAGATCTGAGGTGG + Intronic
1151838321 17:76599035-76599057 GCAAATACAAAGCTGTAAGCAGG + Intergenic
1203157064 17_GL000205v2_random:14357-14379 GCAAACATTCAGACCTAAGCAGG + Intergenic
1156152373 18:34257656-34257678 GCAAAAAGACAGATGTAAGCAGG - Intergenic
1158096586 18:53779114-53779136 TCAAAAAGTCAGATCTAATCAGG - Intergenic
1159258331 18:65977368-65977390 GATACTAGTAAGATCTAAGAGGG - Intergenic
1160067133 18:75586041-75586063 GAAAATAGTAAGAACCAAGATGG - Intergenic
1162858817 19:13490149-13490171 GCACATAGTAAATTCTCAGCAGG - Intronic
1163682907 19:18693778-18693800 GCAAACAGTAAGAGTTAAGCGGG - Intronic
929334604 2:40725821-40725843 GCAAATAGCCAGCTCTCAGCAGG + Intergenic
934698463 2:96418104-96418126 GCAAAAAGGAAGAACAAAGCTGG - Intergenic
937664282 2:124467039-124467061 GTAAATATTAAGATCAAAACAGG + Intronic
937875396 2:126821422-126821444 GCAAACAGAAAGATCTGAACAGG - Intergenic
941051992 2:160745539-160745561 TCAAAAAAGAAGATCTAAGCTGG + Intergenic
941748164 2:169109243-169109265 GCAAATGGCCACATCTAAGCTGG + Intergenic
945494791 2:210497113-210497135 CCAAATAGTAAGATGAAATCTGG - Intronic
947982727 2:234424315-234424337 ACAAGTAGAAAGATCAAAGCTGG + Intergenic
948257115 2:236576568-236576590 TCACTTATTAAGATCTAAGCAGG + Intronic
1170576873 20:17670529-17670551 GAAAACAGTAACATCTAAGTTGG - Intronic
1172892908 20:38279644-38279666 GCATATAGTAAGCACTCAGCAGG - Intronic
1179097899 21:38331860-38331882 GCATATAGTAAGATCCAAGAGGG - Intergenic
950105710 3:10387056-10387078 GCAGTTAGGCAGATCTAAGCAGG - Intronic
958075206 3:88667392-88667414 GAAAATAGTAAGACCTAGCCAGG + Intergenic
960630932 3:119729661-119729683 GAAAAAAGAAATATCTAAGCTGG + Intronic
962111278 3:132451874-132451896 GGAAAGAGTAAAATCTAAGATGG - Intronic
963928752 3:150979472-150979494 AGAAAGAGTCAGATCTAAGCAGG - Intergenic
976018778 4:80594069-80594091 GTAAATAGTAAGATCTTTACAGG - Intronic
976150069 4:82082605-82082627 GCAAAGAATAAGATAGAAGCTGG + Intergenic
977412478 4:96685853-96685875 GCAAATAGAAAAAGCTAAGCCGG + Intergenic
985167089 4:187108022-187108044 ACTCATAGTAAGAGCTAAGCAGG - Intergenic
987286514 5:16463317-16463339 ACAAATAGTGAGATTTAATCTGG - Intronic
987452909 5:18108093-18108115 ACAAATAGAAACTTCTAAGCAGG - Intergenic
988653476 5:33180370-33180392 GCATATAGTAAGAGCTCAGTGGG - Intergenic
990161510 5:52944953-52944975 CCTTATAGTAAGATTTAAGCTGG - Exonic
993767417 5:91878410-91878432 ACAAATAGTATGATCTTGGCCGG - Intergenic
995952702 5:117735682-117735704 CCATATAGAAAGATCCAAGCTGG + Intergenic
998751682 5:145329217-145329239 GCAAAAAGAAAGAACAAAGCTGG - Intergenic
1002762918 6:215699-215721 GCTCATAGTGAGATCTAAGCTGG - Intergenic
1002943236 6:1735724-1735746 GCAGAAAGTTAGATGTAAGCTGG - Intronic
1004495305 6:16157243-16157265 GCAAGTAGTGAGATTTAAGCTGG - Intergenic
1006876851 6:37305164-37305186 GCAAAGAGTCAGATGTAAGATGG - Intronic
1007867438 6:44988083-44988105 GCAAAGAGTGAGATCTAACCAGG + Intronic
1008141963 6:47842272-47842294 GCACATAGTGAGCTCTAAACAGG + Intergenic
1009904065 6:69846939-69846961 GCAAATAGTAACAACTTAACTGG - Intergenic
1010330056 6:74613134-74613156 GCAAATATTAATATCTAATGAGG - Intergenic
1010831706 6:80539388-80539410 GCAAATAGTAAAATATATGTTGG - Intergenic
1011958715 6:93058269-93058291 GCACATAGAAAGATATAAACAGG - Intergenic
1012086380 6:94830864-94830886 GCAAAAATAAAGATCTAAGGTGG + Intergenic
1012420089 6:99055362-99055384 GCAAAAAGAAAAATATAAGCTGG - Intergenic
1012776935 6:103508385-103508407 GCCAATAGTAACAAGTAAGCAGG - Intergenic
1015864813 6:137717415-137717437 GCAAATAATGATGTCTAAGCTGG - Intergenic
1024095194 7:45977250-45977272 GCAAAGAGTAACATCCAAGGAGG - Intergenic
1024958705 7:54952618-54952640 GCAAGGAGAAAGATGTAAGCTGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1040318829 8:46279258-46279280 TTAAATTGTAAGAACTAAGCAGG - Intergenic
1041106623 8:54450860-54450882 GCACATAGTAAGTTCTACACAGG - Intergenic
1041427727 8:57741573-57741595 AGAAACAGTAAGATCTAAGGAGG + Intergenic
1042944200 8:74138380-74138402 GCAAAGAGAAATATCTGAGCAGG - Intergenic
1044399206 8:91750731-91750753 GCAAATAGCAAGGTCTATGAGGG - Intergenic
1044489296 8:92793163-92793185 GGAAATAGGAGGATCTAGGCAGG - Intergenic
1046741669 8:117835735-117835757 GCAAATATTAAAATCTAGTCTGG - Intronic
1051643770 9:19248373-19248395 AAAAGAAGTAAGATCTAAGCAGG - Intronic
1056005800 9:82269699-82269721 GAAAACTGTAAGATCTAAGAAGG - Intergenic
1060789742 9:126478185-126478207 GGAACTAGGAAGATCTAAGCAGG - Intronic
1185534266 X:848298-848320 GCAAAGAGTGAGGTGTAAGCAGG + Intergenic
1194463875 X:94207564-94207586 GTAAATAGTTTGATGTAAGCAGG - Intergenic
1196131149 X:112157926-112157948 GCTAAAAGCAAGATCTCAGCAGG - Intergenic
1198545621 X:137689730-137689752 GCAAATAGGAAGTACTATGCTGG - Intergenic
1200978497 Y:9239269-9239291 TTAAATGGTAAGAACTAAGCAGG - Intergenic
1201370077 Y:13253755-13253777 TTAAATTGTAAGAACTAAGCAGG - Intronic