ID: 909565995

View in Genome Browser
Species Human (GRCh38)
Location 1:77054203-77054225
Sequence GAGTGAACATCTTCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909565995_909565997 17 Left 909565995 1:77054203-77054225 CCTGTGGGAGAAGATGTTCACTC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 909565997 1:77054243-77054265 TCTGACCCACTGAGCTTTATTGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909565995 Original CRISPR GAGTGAACATCTTCTCCCAC AGG (reversed) Intronic
900246709 1:1639689-1639711 GAGAGAACCTCTCCGCCCACAGG + Intronic
900257930 1:1706821-1706843 GAGAGAACCTCTCCGCCCACAGG + Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
901266704 1:7916044-7916066 AAGTGGGCATCTTCCCCCACAGG - Exonic
901453259 1:9349017-9349039 CAGTGAACTTCTTCTCCCAGTGG - Intronic
904730626 1:32588287-32588309 GAGAGAACATCAGATCCCACAGG - Intronic
908787586 1:67750289-67750311 CAGGGAACATGTTCTCCCAGTGG + Intronic
908859134 1:68463654-68463676 AAGGGAACATCTTATCCCCCAGG - Intergenic
909565995 1:77054203-77054225 GAGTGAACATCTTCTCCCACAGG - Intronic
910328201 1:86035859-86035881 CAGAGAACAGTTTCTCCCACTGG - Intronic
922146718 1:222953458-222953480 GAGTGACCATCTTTTCCTATAGG - Intronic
1062828688 10:590397-590419 CACTGAGCATCTTCTCCCAGAGG + Intronic
1064200102 10:13276996-13277018 AAGTGAAGCTCATCTCCCACTGG - Intergenic
1068154375 10:53178117-53178139 TAGTGAACATCGTCTCCAATAGG + Intergenic
1069677549 10:70259461-70259483 GAGTGTACAACTTCTCCCAGTGG - Intronic
1071522817 10:86341493-86341515 GGGTGAGCATCCTCCCCCACAGG + Intronic
1075152460 10:119946613-119946635 GGATGAACATCTTCTTCAACTGG - Intergenic
1077441060 11:2569487-2569509 GAGGGGACTTCTGCTCCCACTGG - Intronic
1079829984 11:25251994-25252016 GAGTTGACACCTTCTCCCAAAGG + Intergenic
1081545406 11:44067918-44067940 GAGTGAAGCTCCCCTCCCACTGG + Intronic
1081755389 11:45540712-45540734 GAATGTACTTCCTCTCCCACAGG - Intergenic
1084453593 11:69254510-69254532 GAGTGAGCACCTCCTCCCACTGG - Intergenic
1092395398 12:8121627-8121649 GAGTGGACATCTCCTCGCTCTGG - Intergenic
1093461315 12:19409413-19409435 GAATGAATATCTTGTCCCAAAGG + Intronic
1097288552 12:57895916-57895938 GATTGTTCATCCTCTCCCACTGG + Intergenic
1098061101 12:66563865-66563887 GAATGAACAGGTTCTCCCAAAGG + Intronic
1098522496 12:71449313-71449335 GAGTTAAGATCTTCCACCACAGG - Intronic
1100539570 12:95545323-95545345 TAGTCAACATATTCTCCCTCTGG - Intronic
1105895752 13:24716291-24716313 GAGGAAAGATCTTCACCCACTGG - Intergenic
1106835814 13:33634348-33634370 TACTGAACAGCTTCTCCCATTGG - Intergenic
1112862101 13:103844036-103844058 GAATAAACATCTTCTCAAACAGG - Intergenic
1124642119 15:31402241-31402263 GGGGGCACATCTTCTCCCAGAGG - Intronic
1132581684 16:687608-687630 CTGTGAACATCCTCTCGCACCGG + Exonic
1134426017 16:14145949-14145971 GAAGGAACAGCTTCTCCCGCAGG - Intronic
1140274939 16:73500211-73500233 ACCTGCACATCTTCTCCCACTGG - Intergenic
1145024846 17:19460459-19460481 AAGTGATGATCTTATCCCACAGG - Intergenic
1146833394 17:36089665-36089687 GAGTGAACAACATACCCCACTGG + Intronic
1151055086 17:71021573-71021595 GAATGAACATCATCTTCCAAAGG - Intergenic
1154018427 18:10641010-10641032 GATTCCACATCTTGTCCCACTGG + Intergenic
1154186446 18:12188565-12188587 GAATCCACATCTTGTCCCACTGG - Intergenic
1158430768 18:57385218-57385240 GAGTGAACATCCTCAGACACAGG - Intergenic
1160863138 19:1245972-1245994 GAGTGAGCAGCTCCTCCCGCTGG - Intergenic
1161033803 19:2072873-2072895 GAGCGGACATCTCCTCCCGCAGG - Exonic
1161206725 19:3045318-3045340 GCGTGAACACCTTCAGCCACAGG + Intronic
1161938082 19:7384413-7384435 GAGAGAACATCTCCACCCCCGGG + Intronic
1162468252 19:10855997-10856019 GAGTAAACCTCTTTTCCCAGTGG + Intronic
1163148815 19:15399410-15399432 CAGTGCCCATCTGCTCCCACAGG - Exonic
1163982055 19:20910090-20910112 GAGTGAACAGCTTCCCACTCTGG - Intergenic
1163982144 19:20911035-20911057 GAGTGAACAGGTTCTCACAGTGG - Intergenic
925031626 2:654250-654272 TAGTGAGCATCATATCCCACAGG - Intergenic
926507083 2:13730261-13730283 GAGTGGACATTTTCTCTGACTGG - Intergenic
927848983 2:26487117-26487139 GAGAGAACCTCTTCTCACCCTGG - Intronic
929435797 2:41927465-41927487 TCCAGAACATCTTCTCCCACAGG - Intergenic
929514319 2:42592694-42592716 CAGTCCACATCTTGTCCCACTGG + Intronic
929856241 2:45640660-45640682 CAGTGAGCAACGTCTCCCACTGG - Intergenic
931434554 2:62235439-62235461 GAGGGAAGCTCTTCTTCCACTGG + Intergenic
931548346 2:63413899-63413921 TTGTGAAGATTTTCTCCCACTGG - Intronic
933786030 2:85842305-85842327 CAGTGACCATCTTGTCACACAGG + Intronic
934785307 2:97000809-97000831 GAGGGAACATCATCACACACTGG - Intronic
936492480 2:112984116-112984138 GTGAGAAGTTCTTCTCCCACAGG - Intronic
941924967 2:170885510-170885532 GAGTGAAGAGCTTCTAGCACTGG - Intergenic
942421725 2:175814672-175814694 GAGTGAACATGGTACCCCACAGG - Intergenic
948219796 2:236260548-236260570 AAGAGAACATTTGCTCCCACAGG + Intronic
1169340509 20:4792853-4792875 AAAAGAACATCTTCTCCCTCCGG - Intronic
1169512849 20:6283945-6283967 GAGAGAACATCAGATCCCACAGG + Intergenic
1174169782 20:48608971-48608993 GAGCAAACATCTTCTCCTCCTGG + Intergenic
1177610303 21:23437877-23437899 AAGTGAACCTCCTTTCCCACTGG + Intergenic
955205464 3:56891996-56892018 GAAAGATCCTCTTCTCCCACGGG + Intronic
956101166 3:65769959-65769981 AAGTGAACATCTTTGCCCAAGGG - Intronic
964118399 3:153159738-153159760 GAGTGCACACCTTAGCCCACAGG + Intergenic
969674481 4:8607386-8607408 GAGAAAACATCTTCTCCTCCTGG - Exonic
970009778 4:11446313-11446335 GAGTCATCAGCTTCTCCCTCAGG - Intergenic
970363835 4:15337850-15337872 CTGGGAACAACTTCTCCCACTGG - Intergenic
972381627 4:38525120-38525142 GGGTGAGCTTCTCCTCCCACTGG + Intergenic
975635431 4:76443520-76443542 CAGTGAACATCTTATCCAAAGGG + Intronic
980111128 4:128638135-128638157 GTGTGTACATTTTCTCCCTCTGG - Intergenic
981163032 4:141521951-141521973 CTGTGAGCATCTTCTCCCAATGG - Intergenic
981397696 4:144273418-144273440 TAGCTAACATTTTCTCCCACTGG - Intergenic
987040376 5:14056443-14056465 TAGTGAACATCATCCCCAACAGG - Intergenic
987961645 5:24817496-24817518 GAATGAATATCTTCTGCAACTGG + Intergenic
995446085 5:112245729-112245751 GAGGGCACATCTACTCACACAGG + Intronic
995559823 5:113368785-113368807 GAGAGAGCATCAGCTCCCACAGG + Intronic
1000322268 5:160143927-160143949 GAGTGAACATCGTCCCTCGCAGG + Intergenic
1001223697 5:169925861-169925883 CAGGGAACATCTTCTCCCCAGGG - Intronic
1003561902 6:7187469-7187491 TAGTGCAAATCTTCTCACACAGG - Exonic
1007000763 6:38310215-38310237 GAGGGAACAACTTGTCCCACTGG + Intronic
1012919658 6:105208458-105208480 GTGTCCACATCTTATCCCACTGG + Intergenic
1013986912 6:116205485-116205507 GAGTCAGCAGCTTCTCCCTCTGG + Intronic
1018680504 6:166260423-166260445 GAGAGAACACCCACTCCCACTGG - Intergenic
1028295296 7:89122449-89122471 GATTTTTCATCTTCTCCCACTGG - Intronic
1031225411 7:119031728-119031750 GATTGAACTTCCTTTCCCACTGG - Intergenic
1032482707 7:132259545-132259567 GAATGCACACCTTATCCCACAGG - Intronic
1033246093 7:139717455-139717477 GAGAAAACATCTTCCCACACAGG + Intronic
1036754553 8:11463760-11463782 GAGGGTTCACCTTCTCCCACTGG - Intronic
1037553540 8:19998812-19998834 GAAGGCACATCTTCTCCCTCAGG + Intergenic
1038232152 8:25711399-25711421 GAGAGAACATGTTCTTACACAGG - Intergenic
1041994926 8:64043128-64043150 GAGTTAATGTCTTCTTCCACTGG - Intergenic
1051500104 9:17767381-17767403 TAGTGTACTTCTTTTCCCACAGG + Intronic
1056370054 9:85944857-85944879 GGGTGAACATCATGTCCCAGGGG - Intronic
1056397839 9:86197667-86197689 TACTGAACATCTTCTGCCACAGG - Intergenic
1060964608 9:127705685-127705707 GCCTGAACAGCTGCTCCCACAGG - Intronic
1186098356 X:6127923-6127945 TTGTAAATATCTTCTCCCACTGG - Intronic
1187412333 X:19062222-19062244 GAGGGGACATCATCTCCCAGAGG + Intronic
1188902646 X:35753030-35753052 CAGTTTACAGCTTCTCCCACAGG + Intergenic
1189553463 X:42117006-42117028 AAGTCACCATCTTCTCTCACTGG + Intergenic
1191165819 X:57390439-57390461 CAGTGAACATTTTATCCCACAGG + Intronic
1195160488 X:102166023-102166045 GAGTGAAAATATTTTCCCAGTGG + Intergenic