ID: 909566213

View in Genome Browser
Species Human (GRCh38)
Location 1:77056146-77056168
Sequence ATGCTGTTTCTGGTGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909566213_909566215 -3 Left 909566213 1:77056146-77056168 CCATGTTGCACCAGAAACAGCAT No data
Right 909566215 1:77056166-77056188 CATCAAAATATATTATTCAGTGG 0: 1
1: 0
2: 2
3: 38
4: 380
909566213_909566216 4 Left 909566213 1:77056146-77056168 CCATGTTGCACCAGAAACAGCAT No data
Right 909566216 1:77056173-77056195 ATATATTATTCAGTGGACAGTGG 0: 1
1: 0
2: 0
3: 24
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909566213 Original CRISPR ATGCTGTTTCTGGTGCAACA TGG (reversed) Intronic
No off target data available for this crispr