ID: 909568060

View in Genome Browser
Species Human (GRCh38)
Location 1:77077755-77077777
Sequence CAGAATAAGTTTTTGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909568057_909568060 -2 Left 909568057 1:77077734-77077756 CCAAATTGGGGTGTTAGTCCTCA No data
Right 909568060 1:77077755-77077777 CAGAATAAGTTTTTGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909568060 Original CRISPR CAGAATAAGTTTTTGGATTT TGG Intergenic
No off target data available for this crispr