ID: 909570414

View in Genome Browser
Species Human (GRCh38)
Location 1:77103847-77103869
Sequence AACTACCTATAGCTGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909570412_909570414 21 Left 909570412 1:77103803-77103825 CCTGCGTTTTTGGCAGAGTTCTA No data
Right 909570414 1:77103847-77103869 AACTACCTATAGCTGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909570414 Original CRISPR AACTACCTATAGCTGGTAGA AGG Intronic
No off target data available for this crispr