ID: 909576125

View in Genome Browser
Species Human (GRCh38)
Location 1:77178295-77178317
Sequence ATGCCCTTCTAGAAGTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 3, 2: 19, 3: 58, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909576125_909576128 7 Left 909576125 1:77178295-77178317 CCTTCATACTTCTAGAAGGGCAT 0: 1
1: 3
2: 19
3: 58
4: 161
Right 909576128 1:77178325-77178347 TAGGTCCTTTTTCCATGGTTTGG 0: 14
1: 15
2: 18
3: 7
4: 111
909576125_909576130 18 Left 909576125 1:77178295-77178317 CCTTCATACTTCTAGAAGGGCAT 0: 1
1: 3
2: 19
3: 58
4: 161
Right 909576130 1:77178336-77178358 TCCATGGTTTGGAGTAAAAACGG 0: 1
1: 7
2: 25
3: 66
4: 222
909576125_909576127 2 Left 909576125 1:77178295-77178317 CCTTCATACTTCTAGAAGGGCAT 0: 1
1: 3
2: 19
3: 58
4: 161
Right 909576127 1:77178320-77178342 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909576125 Original CRISPR ATGCCCTTCTAGAAGTATGA AGG (reversed) Intronic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
906442795 1:45864226-45864248 GTGCCCTTTTAGAAGTCTGGGGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908120144 1:60978737-60978759 AAGCACTTCTAGAGGTAAGATGG + Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
908960574 1:69692443-69692465 ATGCCCTTCTAGCTGTCTAAAGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
911696228 1:100893376-100893398 ATGCCCTTGGAGCAGTGTGAAGG - Intronic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918880945 1:190120026-190120048 ATGCTCGTCTAGCAGTTTGAAGG - Intronic
919085621 1:192917480-192917502 GTGTCCTTCTTGAGGTATGATGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923447637 1:234087420-234087442 GTGCCCCTCTGTAAGTATGAAGG - Intronic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063341972 10:5274517-5274539 ATGGGCTCCTATAAGTATGATGG + Intergenic
1068658498 10:59598891-59598913 ATGCCCTTACATAAATATGAAGG - Intergenic
1069916305 10:71789297-71789319 ATGCCCTTCTTGAGGGATGGTGG - Intronic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1076604764 10:131682302-131682324 AGTTCCTTCTAGAAGTAAGATGG + Intergenic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080238537 11:30099717-30099739 ATTTCCTTCTAGAAGTAACATGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1085206146 11:74733118-74733140 AGGCCTTTTTTGAAGTATGATGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088503609 11:110508024-110508046 AGGCCCTTCTAGGAGCAGGAGGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1091143472 11:133256557-133256579 ACACACTTCTAGAAGTATGTGGG + Intronic
1091726373 12:2849223-2849245 AAGCCCTTCTAGAAGTGTCCAGG + Intronic
1092179841 12:6438580-6438602 ATCACCTTGAAGAAGTATGATGG + Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1094024232 12:25945510-25945532 GTGCCCATCTGGAAGGATGAAGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098675279 12:73283041-73283063 ATTCTCTTCTAGAATTATTATGG + Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101042433 12:100770466-100770488 TAGCCTTTTTAGAAGTATGAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1107074272 13:36304958-36304980 CTCCCTTTCTAGAAATATGAGGG + Intronic
1109275807 13:60302873-60302895 TTTCCCTTCTAGAAGTTTCAAGG - Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111650906 13:91089607-91089629 CTCCCTTTCTAGAAGTAGGATGG - Intergenic
1112667254 13:101589912-101589934 ATGCTCTTCTACAAACATGAGGG - Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1114919707 14:27311393-27311415 ATGCCCTTCTAGAATGCTGCAGG - Intergenic
1115250050 14:31335607-31335629 ATAACTTTCTAAAAGTATGATGG + Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG + Intergenic
1120313738 14:82865149-82865171 ATACCCTTTTAAAATTATGATGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1127029201 15:54843009-54843031 ATTCCCTTATAAAAGTAAGAAGG - Intergenic
1128189891 15:65682196-65682218 ATGCCCATCTAGGACTTTGATGG - Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130725368 15:86433377-86433399 AGCCCCTTCTAGAAGGAGGAAGG + Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134607380 16:15581760-15581782 ATGCCCTTTTCTAAGTATCAGGG + Intronic
1138808066 16:60115798-60115820 TTGCCCTACTAGCAGTATGTGGG + Intergenic
1143152723 17:4817222-4817244 CTGCCCTCCTGGAAGTGTGAAGG - Exonic
1144186888 17:12804986-12805008 GTTCTCTGCTAGAAGTATGAGGG + Intronic
1144187001 17:12806111-12806133 GTCCTCTGCTAGAAGTATGAGGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1146363909 17:32203551-32203573 ATACCCATCTAGAAATATGTCGG - Intronic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1152318962 17:79597365-79597387 AAGCCCTTCTACAAGTCTGTAGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155468772 18:26168948-26168970 ATAACTTTCTAGAATTATGAAGG + Intronic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1157002302 18:43541936-43541958 ATGCCCTGCAAGGAGGATGAGGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1159510573 18:69393562-69393584 ATGCTTTTATAGAAGTCTGATGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1163042299 19:14611546-14611568 ATGCCTTTCTAGAAGTTCCATGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1167475182 19:49696378-49696400 AAGGCCTTCTAGAAGTACCAGGG - Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
926563056 2:14438732-14438754 AGGGCTTTCTAGATGTATGATGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933548465 2:83743502-83743524 AGGCCCTTTTAGAAGGAGGAAGG - Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
938705767 2:133924189-133924211 ATGGCTTTCAAGAAGGATGAAGG + Intergenic
939388548 2:141534776-141534798 ATGCCCTATTTGAAGTCTGAAGG - Intronic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG + Intronic
941716671 2:168771075-168771097 ATGGCCTTCTTGATTTATGAAGG - Exonic
941986070 2:171513071-171513093 AGGGCCTTATTGAAGTATGAAGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943646252 2:190409570-190409592 ATGGACTTCTAGAAGGATTAGGG - Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG + Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1174432162 20:50478361-50478383 ATGCCCTTCGAGGAGGATAAGGG - Intergenic
1175130533 20:56786146-56786168 AGGCCCTTCTAGGCTTATGAAGG - Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1179155860 21:38850650-38850672 TTGCCCTTCCAGAATTTTGAAGG + Intergenic
1180015084 21:45076423-45076445 ATGCCCTGTTAGATGTCTGAGGG + Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952725235 3:36576750-36576772 ATAACATTATAGAAGTATGAAGG + Intergenic
952822265 3:37495609-37495631 TGGCCTTTCTAGAAGCATGATGG - Intronic
954934798 3:54316818-54316840 ATTCCCTTCTAGAAGTCTATTGG + Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959409632 3:106004581-106004603 AAGCCCTTCCAGAGATATGAGGG + Intergenic
962104903 3:132380330-132380352 ATTCCCTTTTAAAAATATGATGG - Intergenic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
962185810 3:133258368-133258390 ATGCCCTTCTTGTAGCTTGATGG - Intronic
963226306 3:142866027-142866049 ATGCTCTTCAATAAGTGTGATGG + Intronic
963622490 3:147629091-147629113 ATGGCCTTCTAGATGGAAGAGGG - Intergenic
963633914 3:147769100-147769122 ATTCCCTTGTAGAAGTAGAAAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965157995 3:165089200-165089222 ATGTCCTTCTAGAATTCAGACGG + Intergenic
966468262 3:180256748-180256770 ATGAACTTCTACAAGTATCAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966686402 3:182700493-182700515 ATGCCCATTCAGAAGTGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
968705934 4:2077506-2077528 CTGCCCTTCCAGAAGTCAGAGGG + Intronic
971643407 4:29164665-29164687 ATGCCGTACTGGAAGTGTGAAGG + Intergenic
971677000 4:29644629-29644651 ATGCCCTTTCAGAAGTTTAAGGG + Intergenic
971919277 4:32915473-32915495 ATGCTCTACTAGAGTTATGATGG + Intergenic
971939436 4:33196389-33196411 ATGCATTTTTAGAAGTAGGATGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974287071 4:59882493-59882515 GTGCACTTCTAGTTGTATGAAGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975265066 4:72353862-72353884 ATGGAATTCTAGAAGTAGGAGGG - Intronic
977169349 4:93741389-93741411 CTGCCCTTGTTGAAGTATGCTGG - Intronic
978092711 4:104737430-104737452 ATTCCCTTGTCAAAGTATGAGGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981431090 4:144661556-144661578 ATGACCTGCTTGAAGTAAGAAGG - Intronic
982474978 4:155839397-155839419 CTGCCATTCCAGAAGTAGGATGG + Intronic
984764126 4:183386474-183386496 ATGCCCTCCTGGCACTATGAGGG + Intergenic
986595897 5:9421448-9421470 ATGCCCTTATATATGTATGCTGG + Intronic
987295582 5:16547655-16547677 AGGCCCTTCTATAAATATAAAGG + Intronic
987334641 5:16888133-16888155 ATGGACTTGTGGAAGTATGAGGG - Intronic
988294692 5:29341018-29341040 ATGGCCTTCAAGAAAGATGATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989707364 5:44352339-44352361 GTCCCCTTTTAGAGGTATGAAGG - Intronic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991602449 5:68367115-68367137 AGGCTATGCTAGAAGTATGAAGG + Intergenic
992834553 5:80627312-80627334 ATAACTTTCTAGAATTATGAAGG + Exonic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993510922 5:88770769-88770791 AGACCCTGCCAGAAGTATGAAGG - Intronic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
999366222 5:151025412-151025434 ATCCCCTTCAAGCAGTATGCTGG + Exonic
1002125594 5:177041235-177041257 ACGCAGTTCTAAAAGTATGATGG - Intronic
1002663739 5:180808166-180808188 CTCCCCTTATAGAAGTAGGAAGG + Intronic
1005343979 6:24871207-24871229 ATGCCCTTCAATAGGTAGGACGG - Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012567502 6:100677137-100677159 AGGCACTTCAAGAAATATGAAGG + Intronic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1017071393 6:150578089-150578111 GTGTCCTTCTGGTAGTATGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021115600 7:16743211-16743233 ATTTCCTGCTAGAAGTTTGAGGG - Intergenic
1023592485 7:41794652-41794674 GTGCCCTTCCTGCAGTATGAGGG - Intergenic
1023598960 7:41862705-41862727 GTCCCCTTCTAGAATTATAAGGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1029523985 7:101083882-101083904 CTGCACTTCTAGAAGGACGAGGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034907121 7:154959541-154959563 AGGCCATTCTTGAAGTGTGAGGG - Intronic
1036208350 8:6821883-6821905 CAGCCCTTCTAGAAATAGGATGG - Exonic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041506378 8:58602981-58603003 GTGTCCTTCAAGAAGTATGGTGG + Intronic
1042079891 8:65040187-65040209 TTACTCTTCTTGAAGTATGAAGG - Intergenic
1043481320 8:80655695-80655717 GTGCCCTTCTGTAAGTATGCAGG + Intronic
1044560487 8:93607089-93607111 ATGACCTTGTATAAGTATGCTGG - Intergenic
1045061026 8:98411346-98411368 ACTCCCTTTTAGAAGTATGCGGG + Intronic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050886905 9:10778269-10778291 CTGCCCATCTAGCAGCATGATGG - Intergenic
1055861874 9:80760722-80760744 AGGCACTACTAGAAGTATGTAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187573836 X:20533085-20533107 TTGCCCTTCTAAATGTATGTAGG + Intergenic
1187794861 X:22992873-22992895 ATGCCCTTTTTGTAGAATGATGG - Intergenic
1190325055 X:49201431-49201453 ATGAATTCCTAGAAGTATGAAGG - Intergenic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic