ID: 909577801

View in Genome Browser
Species Human (GRCh38)
Location 1:77195008-77195030
Sequence ATTCTTCTGCAGGAGCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577801_909577807 25 Left 909577801 1:77195008-77195030 CCACCAAGCTCCTGCAGAAGAAT 0: 1
1: 1
2: 0
3: 17
4: 187
Right 909577807 1:77195056-77195078 CTGTGCACACTGCCCATAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 166
909577801_909577805 2 Left 909577801 1:77195008-77195030 CCACCAAGCTCCTGCAGAAGAAT 0: 1
1: 1
2: 0
3: 17
4: 187
Right 909577805 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG 0: 2
1: 0
2: 0
3: 24
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577801 Original CRISPR ATTCTTCTGCAGGAGCTTGG TGG (reversed) Intronic