ID: 909577803

View in Genome Browser
Species Human (GRCh38)
Location 1:77195018-77195040
Sequence GATTCAGGTTATTCTTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577803_909577805 -8 Left 909577803 1:77195018-77195040 CCTGCAGAAGAATAACCTGAATC 0: 1
1: 1
2: 1
3: 9
4: 161
Right 909577805 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG 0: 2
1: 0
2: 0
3: 24
4: 169
909577803_909577810 30 Left 909577803 1:77195018-77195040 CCTGCAGAAGAATAACCTGAATC 0: 1
1: 1
2: 1
3: 9
4: 161
Right 909577810 1:77195071-77195093 ATAGCAGGAACAACCCAGACTGG 0: 1
1: 0
2: 0
3: 18
4: 176
909577803_909577807 15 Left 909577803 1:77195018-77195040 CCTGCAGAAGAATAACCTGAATC 0: 1
1: 1
2: 1
3: 9
4: 161
Right 909577807 1:77195056-77195078 CTGTGCACACTGCCCATAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577803 Original CRISPR GATTCAGGTTATTCTTCTGC AGG (reversed) Intronic