ID: 909577804

View in Genome Browser
Species Human (GRCh38)
Location 1:77195033-77195055
Sequence CCAGGTCTCTGAGCAGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577804_909577811 20 Left 909577804 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG No data
Right 909577811 1:77195076-77195098 AGGAACAACCCAGACTGGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 214
909577804_909577810 15 Left 909577804 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG No data
Right 909577810 1:77195071-77195093 ATAGCAGGAACAACCCAGACTGG 0: 1
1: 0
2: 0
3: 18
4: 176
909577804_909577807 0 Left 909577804 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG No data
Right 909577807 1:77195056-77195078 CTGTGCACACTGCCCATAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 166
909577804_909577812 25 Left 909577804 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG No data
Right 909577812 1:77195081-77195103 CAACCCAGACTGGTGAGGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577804 Original CRISPR CCAGGTCTCTGAGCAGATTC AGG (reversed) Intronic