ID: 909577805

View in Genome Browser
Species Human (GRCh38)
Location 1:77195033-77195055
Sequence CCTGAATCTGCTCAGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 2, 1: 0, 2: 0, 3: 24, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577800_909577805 9 Left 909577800 1:77195001-77195023 CCAAACTCCACCAAGCTCCTGCA 0: 1
1: 0
2: 0
3: 27
4: 323
Right 909577805 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG 0: 2
1: 0
2: 0
3: 24
4: 169
909577802_909577805 -1 Left 909577802 1:77195011-77195033 CCAAGCTCCTGCAGAAGAATAAC 0: 1
1: 1
2: 0
3: 20
4: 291
Right 909577805 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG 0: 2
1: 0
2: 0
3: 24
4: 169
909577803_909577805 -8 Left 909577803 1:77195018-77195040 CCTGCAGAAGAATAACCTGAATC 0: 1
1: 1
2: 1
3: 9
4: 161
Right 909577805 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG 0: 2
1: 0
2: 0
3: 24
4: 169
909577801_909577805 2 Left 909577801 1:77195008-77195030 CCACCAAGCTCCTGCAGAAGAAT 0: 1
1: 1
2: 0
3: 17
4: 187
Right 909577805 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG 0: 2
1: 0
2: 0
3: 24
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577805 Original CRISPR CCTGAATCTGCTCAGAGACC TGG Intronic