ID: 909577806

View in Genome Browser
Species Human (GRCh38)
Location 1:77195051-77195073
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 0, 3: 52, 4: 265}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577806_909577812 7 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577812 1:77195081-77195103 CAACCCAGACTGGTGAGGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 219
909577806_909577810 -3 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577810 1:77195071-77195093 ATAGCAGGAACAACCCAGACTGG 0: 1
1: 0
2: 0
3: 18
4: 176
909577806_909577818 29 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178
909577806_909577815 21 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577815 1:77195095-77195117 GAGGTGTGGTCATATTACACAGG 0: 2
1: 0
2: 3
3: 7
4: 123
909577806_909577811 2 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577811 1:77195076-77195098 AGGAACAACCCAGACTGGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 214
909577806_909577816 25 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152
909577806_909577817 28 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577817 1:77195102-77195124 GGTCATATTACACAGGAAGGAGG 0: 2
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577806 Original CRISPR TATGGGCAGTGTGCACAGCC AGG (reversed) Intronic