ID: 909577807

View in Genome Browser
Species Human (GRCh38)
Location 1:77195056-77195078
Sequence CTGTGCACACTGCCCATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577802_909577807 22 Left 909577802 1:77195011-77195033 CCAAGCTCCTGCAGAAGAATAAC 0: 1
1: 1
2: 0
3: 20
4: 291
Right 909577807 1:77195056-77195078 CTGTGCACACTGCCCATAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 166
909577801_909577807 25 Left 909577801 1:77195008-77195030 CCACCAAGCTCCTGCAGAAGAAT 0: 1
1: 1
2: 0
3: 17
4: 187
Right 909577807 1:77195056-77195078 CTGTGCACACTGCCCATAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 166
909577803_909577807 15 Left 909577803 1:77195018-77195040 CCTGCAGAAGAATAACCTGAATC 0: 1
1: 1
2: 1
3: 9
4: 161
Right 909577807 1:77195056-77195078 CTGTGCACACTGCCCATAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 166
909577804_909577807 0 Left 909577804 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG No data
Right 909577807 1:77195056-77195078 CTGTGCACACTGCCCATAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577807 Original CRISPR CTGTGCACACTGCCCATAGC AGG Intronic