ID: 909577808

View in Genome Browser
Species Human (GRCh38)
Location 1:77195068-77195090
Sequence GTCTGGGTTGTTCCTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577808_909577812 -10 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577812 1:77195081-77195103 CAACCCAGACTGGTGAGGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 219
909577808_909577817 11 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577817 1:77195102-77195124 GGTCATATTACACAGGAAGGAGG 0: 2
1: 0
2: 0
3: 13
4: 135
909577808_909577818 12 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178
909577808_909577815 4 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577815 1:77195095-77195117 GAGGTGTGGTCATATTACACAGG 0: 2
1: 0
2: 3
3: 7
4: 123
909577808_909577816 8 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577808 Original CRISPR GTCTGGGTTGTTCCTGCTAT GGG (reversed) Intronic