ID: 909577809

View in Genome Browser
Species Human (GRCh38)
Location 1:77195069-77195091
Sequence AGTCTGGGTTGTTCCTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577809_909577818 11 Left 909577809 1:77195069-77195091 CCATAGCAGGAACAACCCAGACT 0: 1
1: 0
2: 3
3: 10
4: 116
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178
909577809_909577816 7 Left 909577809 1:77195069-77195091 CCATAGCAGGAACAACCCAGACT 0: 1
1: 0
2: 3
3: 10
4: 116
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152
909577809_909577815 3 Left 909577809 1:77195069-77195091 CCATAGCAGGAACAACCCAGACT 0: 1
1: 0
2: 3
3: 10
4: 116
Right 909577815 1:77195095-77195117 GAGGTGTGGTCATATTACACAGG 0: 2
1: 0
2: 3
3: 7
4: 123
909577809_909577817 10 Left 909577809 1:77195069-77195091 CCATAGCAGGAACAACCCAGACT 0: 1
1: 0
2: 3
3: 10
4: 116
Right 909577817 1:77195102-77195124 GGTCATATTACACAGGAAGGAGG 0: 2
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577809 Original CRISPR AGTCTGGGTTGTTCCTGCTA TGG (reversed) Intronic