ID: 909577810

View in Genome Browser
Species Human (GRCh38)
Location 1:77195071-77195093
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577803_909577810 30 Left 909577803 1:77195018-77195040 CCTGCAGAAGAATAACCTGAATC 0: 1
1: 1
2: 1
3: 9
4: 161
Right 909577810 1:77195071-77195093 ATAGCAGGAACAACCCAGACTGG 0: 1
1: 0
2: 0
3: 18
4: 176
909577806_909577810 -3 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577810 1:77195071-77195093 ATAGCAGGAACAACCCAGACTGG 0: 1
1: 0
2: 0
3: 18
4: 176
909577804_909577810 15 Left 909577804 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG No data
Right 909577810 1:77195071-77195093 ATAGCAGGAACAACCCAGACTGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type