ID: 909577811

View in Genome Browser
Species Human (GRCh38)
Location 1:77195076-77195098
Sequence AGGAACAACCCAGACTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577804_909577811 20 Left 909577804 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG No data
Right 909577811 1:77195076-77195098 AGGAACAACCCAGACTGGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 214
909577806_909577811 2 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577811 1:77195076-77195098 AGGAACAACCCAGACTGGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577811 Original CRISPR AGGAACAACCCAGACTGGTG AGG Intronic