ID: 909577812

View in Genome Browser
Species Human (GRCh38)
Location 1:77195081-77195103
Sequence CAACCCAGACTGGTGAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577806_909577812 7 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577812 1:77195081-77195103 CAACCCAGACTGGTGAGGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 219
909577804_909577812 25 Left 909577804 1:77195033-77195055 CCTGAATCTGCTCAGAGACCTGG No data
Right 909577812 1:77195081-77195103 CAACCCAGACTGGTGAGGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 219
909577808_909577812 -10 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577812 1:77195081-77195103 CAACCCAGACTGGTGAGGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577812 Original CRISPR CAACCCAGACTGGTGAGGTG TGG Intronic