ID: 909577813

View in Genome Browser
Species Human (GRCh38)
Location 1:77195084-77195106
Sequence TGACCACACCTCACCAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577813_909577818 -4 Left 909577813 1:77195084-77195106 CCCAGACTGGTGAGGTGTGGTCA 0: 1
1: 0
2: 1
3: 13
4: 157
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178
909577813_909577816 -8 Left 909577813 1:77195084-77195106 CCCAGACTGGTGAGGTGTGGTCA 0: 1
1: 0
2: 1
3: 13
4: 157
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152
909577813_909577817 -5 Left 909577813 1:77195084-77195106 CCCAGACTGGTGAGGTGTGGTCA 0: 1
1: 0
2: 1
3: 13
4: 157
Right 909577817 1:77195102-77195124 GGTCATATTACACAGGAAGGAGG 0: 2
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577813 Original CRISPR TGACCACACCTCACCAGTCT GGG (reversed) Intronic