ID: 909577814

View in Genome Browser
Species Human (GRCh38)
Location 1:77195085-77195107
Sequence ATGACCACACCTCACCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577814_909577816 -9 Left 909577814 1:77195085-77195107 CCAGACTGGTGAGGTGTGGTCAT 0: 1
1: 1
2: 0
3: 7
4: 156
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152
909577814_909577817 -6 Left 909577814 1:77195085-77195107 CCAGACTGGTGAGGTGTGGTCAT 0: 1
1: 1
2: 0
3: 7
4: 156
Right 909577817 1:77195102-77195124 GGTCATATTACACAGGAAGGAGG 0: 2
1: 0
2: 0
3: 13
4: 135
909577814_909577818 -5 Left 909577814 1:77195085-77195107 CCAGACTGGTGAGGTGTGGTCAT 0: 1
1: 1
2: 0
3: 7
4: 156
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577814 Original CRISPR ATGACCACACCTCACCAGTC TGG (reversed) Intronic