ID: 909577815

View in Genome Browser
Species Human (GRCh38)
Location 1:77195095-77195117
Sequence GAGGTGTGGTCATATTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 2, 1: 0, 2: 3, 3: 7, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577808_909577815 4 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577815 1:77195095-77195117 GAGGTGTGGTCATATTACACAGG 0: 2
1: 0
2: 3
3: 7
4: 123
909577809_909577815 3 Left 909577809 1:77195069-77195091 CCATAGCAGGAACAACCCAGACT 0: 1
1: 0
2: 3
3: 10
4: 116
Right 909577815 1:77195095-77195117 GAGGTGTGGTCATATTACACAGG 0: 2
1: 0
2: 3
3: 7
4: 123
909577806_909577815 21 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577815 1:77195095-77195117 GAGGTGTGGTCATATTACACAGG 0: 2
1: 0
2: 3
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577815 Original CRISPR GAGGTGTGGTCATATTACAC AGG Intronic