ID: 909577816

View in Genome Browser
Species Human (GRCh38)
Location 1:77195099-77195121
Sequence TGTGGTCATATTACACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577814_909577816 -9 Left 909577814 1:77195085-77195107 CCAGACTGGTGAGGTGTGGTCAT 0: 1
1: 1
2: 0
3: 7
4: 156
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152
909577808_909577816 8 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152
909577809_909577816 7 Left 909577809 1:77195069-77195091 CCATAGCAGGAACAACCCAGACT 0: 1
1: 0
2: 3
3: 10
4: 116
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152
909577806_909577816 25 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152
909577813_909577816 -8 Left 909577813 1:77195084-77195106 CCCAGACTGGTGAGGTGTGGTCA 0: 1
1: 0
2: 1
3: 13
4: 157
Right 909577816 1:77195099-77195121 TGTGGTCATATTACACAGGAAGG 0: 2
1: 0
2: 1
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577816 Original CRISPR TGTGGTCATATTACACAGGA AGG Intronic