ID: 909577818

View in Genome Browser
Species Human (GRCh38)
Location 1:77195103-77195125
Sequence GTCATATTACACAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909577814_909577818 -5 Left 909577814 1:77195085-77195107 CCAGACTGGTGAGGTGTGGTCAT 0: 1
1: 1
2: 0
3: 7
4: 156
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178
909577813_909577818 -4 Left 909577813 1:77195084-77195106 CCCAGACTGGTGAGGTGTGGTCA 0: 1
1: 0
2: 1
3: 13
4: 157
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178
909577809_909577818 11 Left 909577809 1:77195069-77195091 CCATAGCAGGAACAACCCAGACT 0: 1
1: 0
2: 3
3: 10
4: 116
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178
909577806_909577818 29 Left 909577806 1:77195051-77195073 CCTGGCTGTGCACACTGCCCATA 0: 1
1: 1
2: 0
3: 52
4: 265
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178
909577808_909577818 12 Left 909577808 1:77195068-77195090 CCCATAGCAGGAACAACCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 143
Right 909577818 1:77195103-77195125 GTCATATTACACAGGAAGGAGGG 0: 2
1: 0
2: 2
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909577818 Original CRISPR GTCATATTACACAGGAAGGA GGG Intronic