ID: 909583826

View in Genome Browser
Species Human (GRCh38)
Location 1:77266890-77266912
Sequence ACAGGGAAGCAGAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909583815_909583826 15 Left 909583815 1:77266852-77266874 CCCTGAGAAAAGAACATACCTGG No data
Right 909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG No data
909583822_909583826 -3 Left 909583822 1:77266870-77266892 CCTGGAGGGACCTGGGAATCACA No data
Right 909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG No data
909583817_909583826 14 Left 909583817 1:77266853-77266875 CCTGAGAAAAGAACATACCTGGA No data
Right 909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909583826 Original CRISPR ACAGGGAAGCAGAATGAAGA AGG Intergenic
No off target data available for this crispr