ID: 909592926

View in Genome Browser
Species Human (GRCh38)
Location 1:77371785-77371807
Sequence GCAGACTAAAGAATAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909592923_909592926 -10 Left 909592923 1:77371772-77371794 CCATAGATAGTATGCAGACTAAA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 909592926 1:77371785-77371807 GCAGACTAAAGAATAATGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909592926 Original CRISPR GCAGACTAAAGAATAATGGA GGG Intronic
903596341 1:24498237-24498259 GCAGACTCAAGAGAAATGTAGGG - Intergenic
906750693 1:48256866-48256888 GTAGAATAAAAAATTATGGAAGG + Intergenic
906978315 1:50599682-50599704 GCATACCAAAGTATAATGGATGG + Intronic
908598627 1:65714919-65714941 GCAGACTAAAGAAAAGAGCATGG + Intergenic
908939438 1:69413692-69413714 GCAGACAAAATAATAAAGTAAGG + Intergenic
908971495 1:69839563-69839585 GCAGACAAAAGCATCAGGGATGG - Intronic
909367597 1:74845910-74845932 GCAGAACAAAGAATGATGAATGG + Intergenic
909592926 1:77371785-77371807 GCAGACTAAAGAATAATGGAGGG + Intronic
911647047 1:100348662-100348684 GAAGACTAAGGAGAAATGGAAGG + Intergenic
912637433 1:111310784-111310806 GAAGAGTAAAGAAAAATGAATGG - Intronic
914258810 1:145981790-145981812 GGAGACCAAAGAAAATTGGAGGG + Intergenic
916452024 1:164929914-164929936 TCACAGTAAGGAATAATGGAGGG + Intergenic
918908714 1:190535324-190535346 GCAGACTAAATACTAATCAAAGG + Intergenic
920988344 1:210911905-210911927 GCAGAGTAAAGAATCAGGAAGGG - Intronic
921298450 1:213726651-213726673 GCACACCAAAGCATCATGGATGG - Intergenic
921471348 1:215553896-215553918 AGAGACTAAAAAATAATAGAAGG - Intergenic
921673657 1:217953389-217953411 GCAGACTAAAAGAGGATGGAAGG - Intergenic
921979657 1:221242210-221242232 CCAGACTAAGGAATCCTGGATGG + Intergenic
923158265 1:231296999-231297021 GAAATCTAGAGAATAATGGAAGG - Intergenic
924828724 1:247570055-247570077 ACACACTAAAAAATAATAGAGGG - Intronic
1063366524 10:5494133-5494155 GGAGACTAAAGAAGGATTGAAGG - Intergenic
1064646293 10:17463524-17463546 GCAGAATAAAGCAGAATGAAAGG + Intergenic
1064775868 10:18776733-18776755 GCAGAATAAAGAATTCTGGAAGG - Intergenic
1067026751 10:42848853-42848875 GCAAACTAATGAATACTAGATGG - Intergenic
1068279364 10:54848906-54848928 GAAGACTAAAGAAAATTGAAAGG + Intronic
1068722410 10:60260783-60260805 GGAAACTTAAGAATAATGGCAGG - Intronic
1070354182 10:75623332-75623354 GTAAAATAAAGAAGAATGGATGG + Intronic
1070658037 10:78284494-78284516 GGAGACTAATGACTAGTGGAAGG - Intergenic
1071232438 10:83603976-83603998 TAAGACTAAAGAGTAGTGGAAGG - Intergenic
1074844865 10:117388847-117388869 GCAGAGTAGAGAATAAAGTAAGG - Intergenic
1075685705 10:124363956-124363978 GCGGACGAGAGAATAATGGAAGG - Intergenic
1077345213 11:2045097-2045119 GCAAAATGAAGAATAATGTATGG - Intergenic
1077773429 11:5245807-5245829 TCAGAATTAAGAAAAATGGATGG - Intergenic
1078444146 11:11391563-11391585 GCAGATGAAAAAATAAAGGAAGG + Intronic
1079704389 11:23595715-23595737 GCAGACAAAGGAACAAAGGAGGG + Intergenic
1083448260 11:62725502-62725524 GCAGATAAAAAAATAATTGAAGG - Intronic
1085541864 11:77278254-77278276 GCATAATGAAGAATAATGGGGGG - Intronic
1088129392 11:106468775-106468797 ACAGACTTAAGCATAATGAATGG - Intergenic
1090297822 11:125605149-125605171 GCAGACTGGAGAATCAAGGAAGG + Intronic
1091189248 11:133676343-133676365 TGAGACTTGAGAATAATGGAGGG + Intergenic
1091515680 12:1178820-1178842 GTAGACAAATGAATGATGGAGGG - Intronic
1091958590 12:4670955-4670977 CCAGACAAAAGGATAATGGCTGG - Intronic
1092129098 12:6096082-6096104 GGAGACTGAAGAAGGATGGATGG + Intronic
1093051246 12:14507424-14507446 GCAAAATAAAGTATAATGCAAGG + Intronic
1093354470 12:18149247-18149269 CCAGACTAAAGAACCATGCATGG - Intronic
1096761169 12:53843277-53843299 GAAGAATACAGAATACTGGAGGG + Intergenic
1097618459 12:61911240-61911262 ACAGAGTAAAGAATCAGGGAAGG - Intronic
1098189528 12:67933527-67933549 GAAGACTAAAGAATAACTGTAGG - Intergenic
1099791397 12:87339348-87339370 GCAGATTAAAGGATAATTGCAGG - Intergenic
1099904777 12:88759437-88759459 GAAGAAAAAAGAATAATGCAGGG - Intergenic
1100639030 12:96463461-96463483 TCAGACTAAAAAATATTGAATGG + Intergenic
1100894973 12:99171382-99171404 GCAGACAACAGAAAAATGAAAGG + Intronic
1101118216 12:101552695-101552717 TCAGAGCAAAGAATCATGGATGG - Intergenic
1101622862 12:106406942-106406964 GCTGACTGTAAAATAATGGAAGG + Intronic
1101681974 12:106977675-106977697 TCAGGCTACAGAATAAAGGATGG - Exonic
1102698331 12:114817426-114817448 GCAAACTAAACAACAAAGGAAGG - Intergenic
1103081818 12:118030161-118030183 GCATACTAAAGCATATTGGGGGG + Intronic
1103249730 12:119489234-119489256 GAAGAATAAAGAATAGTGTAGGG - Intronic
1104121693 12:125806046-125806068 ACAGACTAAGGAAGAAAGGAGGG - Intergenic
1105699970 13:22928197-22928219 GCAGACTAAATTATAATGTAGGG + Intergenic
1105852774 13:24350381-24350403 GCAGACTAAATTATAATGTAGGG + Intergenic
1106947955 13:34849564-34849586 GGAGAATAAAGCATAATGGAGGG - Intergenic
1108032353 13:46246367-46246389 ACAGACTAAAAAAAAATGAATGG + Intronic
1109177528 13:59174456-59174478 ACAGATTAAAGAATAATAAAAGG + Intergenic
1109280908 13:60354349-60354371 GGAAAATAAAGAATAATGCAAGG + Intergenic
1109529267 13:63619727-63619749 GCAGACTAAATCATAAGGAAGGG - Intergenic
1109679292 13:65727650-65727672 ACAAACTAATGAATAGTGGATGG - Intergenic
1110396865 13:75040248-75040270 GCAGACTGAAGGAGAAAGGAAGG - Intergenic
1110451176 13:75638262-75638284 GCATACTAAAAAAAAAGGGAAGG - Intronic
1110618290 13:77566135-77566157 GGTGACTAAAGAGTAAAGGAAGG + Intronic
1111687874 13:91523536-91523558 GCAGAGAATATAATAATGGATGG + Intronic
1112431600 13:99355263-99355285 GCAGACAAAAGAATGAAGGAAGG + Intronic
1114810446 14:25892756-25892778 ACAAACTACAGAATAATGGCTGG + Intergenic
1115971861 14:38953712-38953734 GCAGACTGGAGACTGATGGATGG + Intergenic
1119218379 14:72886584-72886606 GCACAATAAAGAAAAATTGAGGG + Intronic
1120493895 14:85210078-85210100 GAACACTAAAGAATATTGGATGG + Intergenic
1122841470 14:104466112-104466134 GCAGACTAAATTATAATGTAAGG + Intergenic
1124414783 15:29466202-29466224 GCAGGTTAAAGAAGAAAGGAGGG + Intronic
1124471672 15:29992566-29992588 GCAGACTATGGAATAATGTGTGG - Intergenic
1125077639 15:35638218-35638240 GAAGAATAAAGAATCATGCATGG + Intergenic
1125280034 15:38033553-38033575 ACAGACAAAAAAAAAATGGAGGG - Intergenic
1125435669 15:39642515-39642537 GCAGAATAAAGAATGCTGCATGG + Intronic
1126303703 15:47229767-47229789 ACATAATAAAGAATAAAGGATGG - Intronic
1126898420 15:53285796-53285818 GAACCCCAAAGAATAATGGATGG - Intergenic
1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG + Intronic
1126946583 15:53828421-53828443 GCAGAAAAAATAAGAATGGAAGG + Intergenic
1133713018 16:8419779-8419801 CCAGGCTAAAGAATAATGACTGG + Intergenic
1135156367 16:20056385-20056407 ACAAACGAAAGAACAATGGAAGG + Intronic
1135468815 16:22711374-22711396 GAAGACTTAAGAATAATGGAAGG + Intergenic
1138249942 16:55494130-55494152 GATGAATAATGAATAATGGATGG - Intronic
1138835109 16:60425093-60425115 GATGACTATAGAATAATGTAGGG - Intergenic
1139086736 16:63596408-63596430 ACACACAAAAGAATAAGGGAGGG - Intergenic
1139132204 16:64160044-64160066 GCATGCTTAAGAATAATGTATGG + Intergenic
1139685709 16:68602006-68602028 GCATAGGAAAAAATAATGGAAGG + Intergenic
1140961595 16:79918068-79918090 GCAGACTGCAGGATAATGTAGGG + Intergenic
1142021927 16:87789099-87789121 GGAGACCAAAAAATAATGGCAGG + Intergenic
1143189434 17:5031102-5031124 TCAGAGTAAAGAAAAAGGGAAGG - Intergenic
1145830297 17:27910801-27910823 GCAGACTAAACAGCAATGCAAGG + Intergenic
1146146701 17:30425104-30425126 AGAGACTAAAGAAAACTGGAGGG - Intronic
1146674858 17:34766246-34766268 GCAGAGTACAGGATAAAGGAAGG + Intergenic
1147978993 17:44263216-44263238 GAAGACTAGAGAATGAAGGAGGG - Intronic
1153053419 18:922082-922104 GCAGATTATATAATAATGGTTGG + Intergenic
1153555935 18:6313315-6313337 GCATTCTAAAGGATAATGTATGG - Intronic
1156076636 18:33287247-33287269 GCATACCAAAAAATAATGCATGG + Intronic
1157268498 18:46249820-46249842 GCAATCTGAAGAATAATGAAAGG - Intronic
1158448143 18:57539024-57539046 GTAGATAAAAGAAAAATGGAGGG + Intergenic
1159536325 18:69719521-69719543 GCAAACTAAGGAACAATGGCTGG + Intronic
1160446908 18:78935091-78935113 GCAGGCTGAATAACAATGGAAGG - Intergenic
928910620 2:36417129-36417151 AAAGACAAAAGAATAAGGGAAGG - Intronic
930200506 2:48548317-48548339 GCAGACAAAAGTGGAATGGAAGG - Intronic
930543231 2:52734132-52734154 GCAGTCTAAAGAGAGATGGAAGG - Intergenic
933068865 2:77833516-77833538 GCAGAATAAAGAATAAATAAAGG + Intergenic
934062198 2:88305420-88305442 GCAGAGAAAGGAGTAATGGAGGG - Intergenic
935484892 2:103641012-103641034 CTTGACTAAAGAATAATGGGGGG + Intergenic
935545649 2:104397016-104397038 ACAGAGTAAAGAAGGATGGAAGG + Intergenic
936511284 2:113149626-113149648 GCAGAGGGAAGAATAAAGGAGGG - Intergenic
941989088 2:171537350-171537372 GGAAACTAAAGAATTATGTAGGG + Intronic
942683296 2:178502647-178502669 GAATTCTAAAGAAAAATGGATGG - Intronic
942756920 2:179351950-179351972 GAAGAACAAAGACTAATGGAAGG + Intergenic
944041121 2:195355999-195356021 GAAGACTAAAAAATATTGAATGG - Intergenic
945337029 2:208604364-208604386 GAAGACTAAAGAGTCTTGGAGGG - Intronic
945489915 2:210442857-210442879 GGAAAATAAAGAAAAATGGAGGG - Intronic
945735194 2:213590014-213590036 GCAAACTGAAGAAGAATGGGAGG - Intronic
945829256 2:214763438-214763460 GAAGACTTAAGAAGAAAGGAAGG + Intronic
946230101 2:218285998-218286020 GGAGGCTAGAGAAGAATGGAGGG + Intronic
946250435 2:218408109-218408131 GCAGAATAAAGAGGAAAGGAAGG + Intergenic
946371222 2:219282626-219282648 CCACAATAAAGAATAAAGGAAGG - Intronic
1170947440 20:20903974-20903996 TCAGACATAAGAATAGTGGATGG + Intergenic
1171107431 20:22448284-22448306 GCAGCCTAAAGGGTAAAGGAGGG + Intergenic
1177640787 21:23842078-23842100 GGAGAGTAAAGAAAAATGGCTGG - Intergenic
1177747757 21:25241381-25241403 GCATTTTAAAGAAAAATGGAAGG - Intergenic
1182366996 22:29785949-29785971 GCAAACAAAAGAAAAATGCAAGG - Intergenic
949933562 3:9099376-9099398 TCAGAGCATAGAATAATGGATGG + Intronic
951077651 3:18415906-18415928 ACAGACTAAAAAAAAATTGAAGG + Intronic
952249789 3:31641110-31641132 GCAAATTAAGGAACAATGGAGGG - Intergenic
955430055 3:58833873-58833895 TCAGCCTAAAGAGTAATGAAGGG + Intronic
955437025 3:58912085-58912107 CCAGAATAAAGAATATGGGAGGG - Intronic
956329600 3:68091464-68091486 GCAGACTGAGGAATCTTGGAAGG - Intronic
959341221 3:105134449-105134471 GCAGAAGAAAGAAAAAGGGATGG + Intergenic
959599025 3:108158242-108158264 GCCGACTAAATAAAAATTGAGGG + Intergenic
959714555 3:109418045-109418067 GCAGATGCAAGAATAATGAAAGG + Intergenic
963144223 3:141975829-141975851 GCAGATTAAATAATAATAAAGGG + Intronic
964942378 3:162174711-162174733 GAAGACAAAAAAATAATTGAAGG - Intergenic
965528411 3:169746212-169746234 GCAGAATAAATCATAATGGTTGG - Intergenic
967975043 3:195029573-195029595 GCAGGCCACAAAATAATGGATGG - Intergenic
969934375 4:10666493-10666515 ACAGTCAAAGGAATAATGGAAGG + Intronic
970924179 4:21431410-21431432 GCAAACTAAAGAATTATGGTTGG - Intronic
973122139 4:46534655-46534677 GAAGACCAAAACATAATGGAAGG + Intergenic
973255575 4:48108869-48108891 GCAAATTAATGAATAATGAAAGG + Intronic
973686636 4:53377334-53377356 GCTGATTAAAGAATAAAAGAAGG + Intergenic
973836551 4:54815845-54815867 GCAGAATGGAGAAGAATGGAGGG - Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
976689953 4:87858230-87858252 TCAGACTAAAGTTTAATAGAAGG - Intergenic
977243025 4:94596597-94596619 GCAGACTTCAAAATCATGGAAGG + Intronic
977329724 4:95622148-95622170 GCAGAATGAAGAATCATGGAGGG + Intergenic
978309533 4:107371138-107371160 GGATACTAAAGAATACTGTAAGG + Intergenic
978836000 4:113150287-113150309 GCAAACAAAAGAATAATGCTTGG + Intronic
979800508 4:124902952-124902974 ACAGACTAAAGAATAATGGCAGG + Intergenic
981234937 4:142404725-142404747 ACAGACTAAAGAATACCGGGGGG + Intronic
981874104 4:149520084-149520106 GCCCACTAAATAATAATGGTAGG + Intergenic
981891292 4:149741240-149741262 GAAGACCAGAGAATAAGGGAGGG - Intergenic
983956110 4:173700560-173700582 GCAAACAAAACAATAATGAAAGG + Intergenic
984120045 4:175730870-175730892 GCAGTGTCAAGAAAAATGGAGGG - Intronic
984978857 4:185258016-185258038 GAACACTAAAGAATAAGGAAGGG + Intronic
991380574 5:66019359-66019381 GCTACCTAAAGAATACTGGAGGG + Intronic
991591776 5:68259047-68259069 TCACACTAAAGAAAAATTGAAGG + Intronic
991639926 5:68742055-68742077 GAACATGAAAGAATAATGGAAGG - Intergenic
991976331 5:72186828-72186850 GGAGACAAAAGAAGAAGGGAGGG + Intronic
994829666 5:104763196-104763218 GCAGACTTGAGAAAAATGAAGGG + Intergenic
995191308 5:109321749-109321771 ACAAACTAAACAATAATGAAAGG - Intergenic
996409987 5:123147828-123147850 GAAGACTCCAGAATGATGGATGG + Intronic
997418800 5:133750055-133750077 GCTGACTAAAGGTTAATGGGAGG + Intergenic
1000429907 5:161139013-161139035 CGAGGCTAAAGAATAATGTATGG + Intergenic
1000674795 5:164107313-164107335 GCAGACTAAAAAAAAAAGAAAGG - Intergenic
1004092693 6:12520710-12520732 TCAGACAAAAGATTGATGGATGG - Intergenic
1004900681 6:20190973-20190995 GCAGAATTAAGCCTAATGGATGG - Intronic
1007707556 6:43799971-43799993 GAAGACTAAAGAAGAGGGGAGGG + Intergenic
1008682213 6:53884625-53884647 GCAGACTAAGAATGAATGGAAGG - Intronic
1009214652 6:60906704-60906726 GCAGACAAATGGATAATGGGTGG - Intergenic
1009795306 6:68458480-68458502 CCCGACTATAGAAGAATGGAAGG + Intergenic
1009822355 6:68819419-68819441 GCAGACAAAAGAAGAAAGGCAGG - Intronic
1012421240 6:99067689-99067711 GCCTATTAAGGAATAATGGAAGG + Intergenic
1013108083 6:107043029-107043051 TCAGAATAAACATTAATGGAGGG + Intronic
1013326360 6:109048185-109048207 GAAGACAAAAGATTAAGGGAGGG - Intronic
1013676989 6:112476171-112476193 GCAGAATAAAGAACAATGTATGG - Intergenic
1014149074 6:118032519-118032541 GGAGACAAAAGAAAGATGGAAGG - Intronic
1016023613 6:139261271-139261293 TCAGACTAAAGAAGATAGGAAGG - Intronic
1016132411 6:140491960-140491982 TCAGAACAAAGAATATTGGATGG - Intergenic
1017962925 6:159237765-159237787 GCAGAGAAAAAAATTATGGAAGG - Intronic
1018917374 6:168143956-168143978 ACAGACTAAAAATAAATGGATGG - Intergenic
1019187127 6:170227280-170227302 GAAGGCTAAAGAAAAATGGTGGG + Intergenic
1020581301 7:10005696-10005718 CAAGACTAAAGAATAATGCCAGG - Intergenic
1020752266 7:12157191-12157213 GCTGAAGTAAGAATAATGGAAGG + Intergenic
1021003937 7:15370057-15370079 GGGGACTAAGGAATAAAGGAGGG - Intronic
1022534635 7:31088797-31088819 GAAAACAAAAGAATAATGAAGGG - Intronic
1022914430 7:34933640-34933662 GCAGGCAAAAGAATTGTGGAAGG + Intronic
1029867138 7:103645409-103645431 ACAGACTAAAGATAAAGGGATGG + Intronic
1029921043 7:104264284-104264306 GCAAGCTAAAGAATAATGGCTGG - Intergenic
1029996559 7:105013301-105013323 GGAGACCAAAGAATAAAAGAAGG - Intergenic
1031892226 7:127308439-127308461 GCAGACGAATGAGTAATGGAGGG - Intergenic
1036296061 8:7538576-7538598 ACAGTATAAAGAATAATAGATGG - Intergenic
1036326505 8:7782443-7782465 ACAGTATAAAGAATAATAGATGG + Intergenic
1038543645 8:28409252-28409274 GCAGAGGAGAGAATAATGGTTGG + Intronic
1039618087 8:38972926-38972948 AAAAATTAAAGAATAATGGATGG - Exonic
1041330579 8:56719614-56719636 GAAGACAAAAGAATAACTGAAGG - Intergenic
1041564935 8:59266063-59266085 GCAGACTAAAATTTTATGGATGG + Intergenic
1041738720 8:61137297-61137319 GCAGAGTAAACATTCATGGAGGG + Intronic
1042471296 8:69191459-69191481 GCCAACTAAAAAATAATTGAAGG + Intergenic
1043510769 8:80948280-80948302 AAAGACTAAAGAAAAATGGATGG + Intergenic
1043841784 8:85114190-85114212 GCAGAGAAAAGAAAAATGCAAGG - Intronic
1043938187 8:86167397-86167419 GCAGAGTAAAGGAGATTGGAGGG - Intergenic
1044845656 8:96378145-96378167 CTAGACAAAAGAATAATGCATGG - Intergenic
1045540869 8:103083600-103083622 TCAGAACAAAGAATACTGGAAGG + Intergenic
1045611433 8:103847407-103847429 TCAGACTAAAGAGTTCTGGATGG + Intronic
1047765018 8:127983261-127983283 GAAGAAGAAAGAAAAATGGATGG - Intergenic
1050244565 9:3674728-3674750 GAAGACCAAAAAATTATGGAGGG + Intergenic
1051068499 9:13134280-13134302 ACACAGTAAAGAATAATGAATGG - Intronic
1052491702 9:29178002-29178024 GCAGAGAAAAAAAAAATGGAAGG - Intergenic
1053392934 9:37748899-37748921 GAAGAATAAATAATCATGGAAGG + Intronic
1055169150 9:73233589-73233611 ACAGAATATAGAAAAATGGAGGG + Intergenic
1055398958 9:75902441-75902463 ACAAACAAAAGAAAAATGGATGG + Intronic
1056537349 9:87541245-87541267 GCACTTTAAAGAATGATGGAGGG + Intronic
1058027621 9:100159599-100159621 ACAGACTAAACTATAATAGAAGG + Intronic
1059250680 9:112885291-112885313 GCAGAGTAGAAAATAAAGGAAGG - Intronic
1059268517 9:113058145-113058167 GAAGACTGAAAAATAATTGATGG + Intergenic
1059722778 9:116977469-116977491 CCAGAAAAAAAAATAATGGATGG - Intronic
1060000350 9:119952923-119952945 CCAGGCCAGAGAATAATGGATGG + Intergenic
1188349905 X:29115962-29115984 GCAAATTAAAGAATAATCAATGG + Intronic
1188629725 X:32339512-32339534 GCAGACCAAAGCATAGTAGAGGG - Intronic
1195616352 X:106915627-106915649 ACAGACTTAAGAAGAAAGGAAGG - Intronic
1197289317 X:124636354-124636376 GCAGATTGAAAAATAAGGGAAGG - Intronic
1198134078 X:133729289-133729311 GGAGACTGAGGAATAATGGAGGG - Intronic
1198666359 X:139027789-139027811 GCAGACCAAAAAAAAATGAAAGG + Intronic
1199515517 X:148670768-148670790 GCACACTGAAAAAGAATGGATGG - Intronic
1201210711 Y:11677980-11678002 GCAGACTCGAATATAATGGATGG + Intergenic
1201300176 Y:12498449-12498471 GCAGAAGAAAGAAAGATGGAGGG - Intergenic