ID: 909594203

View in Genome Browser
Species Human (GRCh38)
Location 1:77386832-77386854
Sequence GGTGAGCGCAGGCAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 654}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909594203 Original CRISPR GGTGAGCGCAGGCAGGGAGA GGG (reversed) Intronic
900488767 1:2935939-2935961 AGTGGGCACAGGGAGGGAGACGG + Intergenic
900934054 1:5754236-5754258 GGAGCAGGCAGGCAGGGAGAAGG + Intergenic
901066575 1:6497298-6497320 GGTGAGTGCAGGCGGGGACCCGG - Intronic
901420878 1:9150359-9150381 GATGGGCCCAGGCAGGGAGGCGG + Intergenic
902226024 1:14996877-14996899 GGTGAGGTCAGGCAGGGAGGTGG - Intronic
902616684 1:17627514-17627536 GGTGAGGGCAGGCAGGTGGGAGG - Intronic
902724688 1:18326891-18326913 GGGGGCCTCAGGCAGGGAGATGG + Intronic
902746268 1:18476573-18476595 GGAGACACCAGGCAGGGAGATGG - Intergenic
902752967 1:18530129-18530151 GGTGAGAGCAGACAGTGAGGAGG - Intergenic
902768602 1:18632700-18632722 GGGGAGAGGAGGCAGGGAGGGGG + Intronic
903176975 1:21587221-21587243 GGTGTGGGCAGGCAGGGTGCGGG + Intergenic
903281935 1:22255042-22255064 GGTGAGCAAAGGCAGGGAGGTGG + Intergenic
903565023 1:24258778-24258800 GGAGACCACAGGCAGGGAGCTGG - Intergenic
903665742 1:25006425-25006447 GGTGAGCCCAGGGAGGGCAAGGG + Intergenic
904410977 1:30324799-30324821 GGAGAGAGCAGGGAAGGAGAGGG + Intergenic
904426445 1:30426609-30426631 GGTGAGCGGAGGCTTGGAGCAGG + Intergenic
904456254 1:30649909-30649931 GAGGAAGGCAGGCAGGGAGAAGG - Intergenic
904456517 1:30651436-30651458 GGAGTGGGCAGGCAGGGAGGAGG - Intergenic
904456534 1:30651484-30651506 GGAGTGGGCAGGCAGGGAGGAGG - Intergenic
904456551 1:30651532-30651554 GAGGTGAGCAGGCAGGGAGAAGG - Intergenic
904456560 1:30651570-30651592 GGAGTGGGCAGGCAGGGAGGAGG - Intergenic
904456577 1:30651618-30651640 GAGGTGGGCAGGCAGGGAGAAGG - Intergenic
904456617 1:30651742-30651764 GGAGTGGGCAGGCAGGGAGGAGG - Intergenic
904960949 1:34332406-34332428 GGTGAAGGCAGGCAGAGAGTTGG - Intergenic
905651326 1:39659002-39659024 GATGAGGGCAGACAGGCAGAAGG + Intergenic
905678326 1:39846188-39846210 GGAGAGCTCAGGCAGAGAGTGGG + Intronic
906480230 1:46194711-46194733 GATGAAAGTAGGCAGGGAGATGG - Intronic
907299489 1:53477694-53477716 GGGGAGACCAGTCAGGGAGAAGG + Intergenic
907410175 1:54278372-54278394 GTTAAGGGCTGGCAGGGAGATGG - Intronic
907443868 1:54495091-54495113 GGTGAACTCAGGTAGGGAGGAGG + Intergenic
908477660 1:64505587-64505609 GGTGTGCCCAGGGAGGGGGAGGG - Intronic
909038054 1:70617502-70617524 GATGATCCCAGGCTGGGAGATGG + Intergenic
909594203 1:77386832-77386854 GGTGAGCGCAGGCAGGGAGAGGG - Intronic
909703611 1:78554024-78554046 AGTAAGAGCGGGCAGGGAGAGGG - Intergenic
910450129 1:87335463-87335485 GGCGAGCGCAGGGCGGGAGCCGG + Intronic
911802333 1:102157807-102157829 GGTGAGCTGAGGCAGGTGGATGG - Intergenic
912990581 1:114482459-114482481 AATGAGTGCAGGGAGGGAGATGG + Intronic
915330989 1:155112261-155112283 GGTGAGGGCAGTCAAGGATAAGG - Intergenic
915952643 1:160199756-160199778 GGTCAGCCCAGGGATGGAGAGGG - Intronic
916489233 1:165286964-165286986 GGTGAGAGGGGGCAGAGAGATGG - Intronic
916504542 1:165416245-165416267 AGTGAGCTCAAGCAGGGACATGG - Intronic
916963314 1:169910673-169910695 GGGGGGCGCAGGCAGGGGCAGGG - Intergenic
917837708 1:178954024-178954046 TATGAGCTCAGGCTGGGAGAGGG - Intergenic
919754145 1:201056271-201056293 GCTGAGCTCTGGCAGGGAGTAGG - Intronic
920156491 1:203956226-203956248 GGAGAGAGGAGGAAGGGAGATGG + Intergenic
920309952 1:205043141-205043163 AGTGAGCGGAGCCTGGGAGAGGG + Intergenic
920313084 1:205059743-205059765 GGTGAGGGCAGGCAGAGTCAGGG + Intronic
920541991 1:206785627-206785649 AGAGAGGGCAGCCAGGGAGAGGG + Intergenic
920771744 1:208892939-208892961 GGGGAGAGGAGGCAGGCAGAAGG + Intergenic
922101530 1:222481285-222481307 GGGGAGCTGAGGCAGGAAGATGG - Intergenic
922262611 1:223956401-223956423 GGGGAGCTGAGGCAGGAAGATGG - Intergenic
922640692 1:227228121-227228143 GGTGGGGGCAGGCCGGGAGAGGG + Intronic
922872921 1:228917612-228917634 GGTAAGGGCAGGCAGGGAGCTGG + Intergenic
923056013 1:230426287-230426309 GGAGAGGGCGGGCAGGGAGGCGG - Intergenic
923337262 1:232981183-232981205 GGTAAGCACATGCAGGGAGATGG + Exonic
923520698 1:234733062-234733084 GTCCAGGGCAGGCAGGGAGATGG + Intergenic
923783751 1:237048500-237048522 TGTGAGCTGAGGCTGGGAGATGG - Intronic
924024056 1:239814466-239814488 GGTGAGGGCTGGGAGGCAGAGGG - Intronic
924344451 1:243061402-243061424 GGGGAGCTGAGGCAGGAAGATGG - Intergenic
924592100 1:245413807-245413829 GGAGAGTGGAGGGAGGGAGATGG + Intronic
924603234 1:245509849-245509871 GCTGAAGGCAGGAAGGGAGAAGG - Intronic
1063121353 10:3107015-3107037 GGTGACAGCAGGGAGGGACAGGG - Intronic
1063613597 10:7583766-7583788 GGAGAGCACAGGCAGAGGGACGG + Intronic
1063631449 10:7738319-7738341 GGGGAGCGAAGTCTGGGAGAAGG - Intronic
1064113325 10:12557001-12557023 GGGGAGAGCAGGGAGGGAGACGG + Intronic
1064134221 10:12736732-12736754 GGCGAGAGCGGCCAGGGAGATGG - Intronic
1064134901 10:12742079-12742101 AGTGGGCGTAGGCAGAGAGAGGG - Intronic
1064353338 10:14596756-14596778 GGTGAGAGGAGGCAGGGCGTCGG - Intronic
1065342034 10:24716555-24716577 GGTGCGCTCAGGGAGGGGGAAGG + Intronic
1065417069 10:25499886-25499908 GGTGAGCTCAGAGAGGCAGACGG + Intronic
1065850506 10:29783790-29783812 GGTGAGGGCTGCCAGGGGGAAGG + Intergenic
1066013737 10:31217423-31217445 GCTGAGAGGAGGCAGGGAAAGGG + Intergenic
1066220720 10:33334968-33334990 GGCGAGCCCAAGCGGGGAGAGGG - Intronic
1066731882 10:38443667-38443689 GGGGAGCTGAGGCAGGAAGATGG + Intergenic
1067067506 10:43112197-43112219 TGTGAGTGGAGGCAAGGAGATGG + Exonic
1067171763 10:43912595-43912617 GGTGAGCACAGACAGAGAGATGG - Intergenic
1067419555 10:46134240-46134262 TGTGAGCACAGGCAGGGAAATGG + Intergenic
1067426464 10:46215171-46215193 TGTGAGCACAGGCAGGGAAATGG - Intergenic
1067458695 10:46441434-46441456 GAGGTGCCCAGGCAGGGAGACGG + Intergenic
1067474360 10:46556391-46556413 TCTGAGCGCAGGCAGCGGGAAGG + Intergenic
1067504906 10:46840837-46840859 TGTGAGCACAGGCAGGGAAATGG + Intergenic
1067628499 10:47943202-47943224 GAGGTGCCCAGGCAGGGAGACGG - Intergenic
1067878427 10:50024285-50024307 GGTGAGCAGGAGCAGGGAGAAGG - Intergenic
1067893295 10:50153643-50153665 GGTGAGCAGGAGCAGGGAGAAGG + Intergenic
1068758798 10:60684216-60684238 GGGGCGCGCAGGCAGGGGGTGGG + Intronic
1069874473 10:71553269-71553291 GCTGGACCCAGGCAGGGAGAGGG - Intronic
1070385948 10:75924766-75924788 GGAGAGCACAGGCAGGGAGTGGG + Intronic
1071137253 10:82466840-82466862 GGTGAGGACAGGCAAGGGGAAGG + Intronic
1071436274 10:85650721-85650743 GGTGAGTAGAGGCAGCGAGATGG + Intronic
1073058223 10:100715547-100715569 GATGGACGCAGGCAGGAAGACGG + Intergenic
1073556091 10:104453148-104453170 GGTGAGAGAGGGCAGGGGGAGGG + Intronic
1074022168 10:109595313-109595335 GTTAAGGGCAGCCAGGGAGAAGG + Intergenic
1075575904 10:123577301-123577323 GGGGAGCCCAGGCATGGAGGAGG + Intergenic
1075630620 10:123998705-123998727 GGTGAGCAGGGGCAGGGAGCAGG - Intergenic
1075664505 10:124221070-124221092 GGAGAGCCCAGCCAAGGAGAGGG + Intergenic
1075810734 10:125222861-125222883 GCGGAGAGCAGTCAGGGAGAAGG - Intergenic
1076251106 10:128984471-128984493 TGTGGGCACAGGCAGGAAGAAGG - Intergenic
1076808334 10:132871273-132871295 GGTGTTAGCAGGCACGGAGAAGG - Intronic
1076912675 10:133399509-133399531 GTTCTGCGCAGGCAGAGAGAGGG - Exonic
1077034064 11:486407-486429 GGGGAGCGCAGGTGTGGAGATGG + Intronic
1077054499 11:584388-584410 GGTGAGCGCAGACACGGTGGGGG - Intronic
1077176904 11:1195233-1195255 GGTGATGGCAGGCACGGAGCAGG - Intronic
1077224435 11:1433926-1433948 GGTGAGCCCAGGCCGGGTGGGGG - Intronic
1077286397 11:1767890-1767912 GCTGACCGCATGCAGGGACATGG + Intergenic
1077532501 11:3103804-3103826 GGGCTGCGCAGGCAGGAAGAGGG - Intronic
1079500797 11:21099293-21099315 GCTGGGCTCAGGCAGGGAAAAGG + Intronic
1080415268 11:32064216-32064238 GGTCAGCTCAGGCAGGATGATGG - Intronic
1080656303 11:34261116-34261138 GGGGGGGGCAGGCGGGGAGATGG - Intronic
1081650192 11:44818603-44818625 GGATAGGGCAGGCAGGCAGAGGG - Intronic
1081732709 11:45382832-45382854 GGTGGGGGCAGGCAGGCAGAAGG - Intergenic
1081871764 11:46385928-46385950 GATGACCACAGGCAGGTAGAAGG + Exonic
1081906331 11:46672694-46672716 GGTGACAGCAGGCAGGGAAGGGG - Exonic
1082909464 11:58353969-58353991 GGTGAGGGCAGGGATGGAGTGGG + Intergenic
1083309937 11:61778984-61779006 GGAGAGCTCTGGCAGGGAGTGGG + Intronic
1083852992 11:65378745-65378767 TGTGAGCATAAGCAGGGAGAGGG - Intronic
1083880872 11:65547668-65547690 GGTGAGCGCCGCCAGGGCGGAGG - Exonic
1084006431 11:66325914-66325936 GGTGGGGGGAGGCAGGGACAGGG - Intergenic
1084549125 11:69830567-69830589 GGAGACAGAAGGCAGGGAGAGGG - Intergenic
1084610215 11:70197446-70197468 GGTGAGGGCCGGCAGGGATGTGG + Intergenic
1084779125 11:71397174-71397196 GATGAGCGTAGACACGGAGAGGG - Intergenic
1084786945 11:71448151-71448173 CGTGCGCGCAGGTGGGGAGAGGG - Intronic
1085029899 11:73264655-73264677 GGCGTGCGCGGGCAGGGACAGGG + Intronic
1085038438 11:73313202-73313224 AGAGAGAGCAGGCAGGGAGTGGG + Intronic
1085323331 11:75588217-75588239 GTAGAGCTCAGGCAGGGACAGGG + Intronic
1085323826 11:75591687-75591709 GGGGTGCACAGGCTGGGAGAAGG - Intronic
1085399938 11:76230004-76230026 TGTGAGTGCAGATAGGGAGAAGG + Intergenic
1085816805 11:79746074-79746096 GGGGAGTGTAGGCATGGAGAAGG - Intergenic
1088416141 11:109590977-109590999 GGTGTGGGCAGGCAGGAAGTTGG + Intergenic
1089297400 11:117478301-117478323 GATGTGCGCCGGCAGGGAGGCGG + Intronic
1089317297 11:117600774-117600796 GGTGTTTCCAGGCAGGGAGAAGG + Intronic
1089809532 11:121120457-121120479 TGTGGGGACAGGCAGGGAGAGGG + Intronic
1090066740 11:123510208-123510230 GGGGGGAGCAGGAAGGGAGAAGG - Intergenic
1090199560 11:124844612-124844634 AGAGAGAGCAGGCAGGGTGATGG + Intergenic
1090484197 11:127097905-127097927 GGTGAGTGGAGGGAGGGAAAGGG - Intergenic
1090844951 11:130522593-130522615 GGTCAGCACAGGCATGGTGAGGG + Intergenic
1091087211 11:132733256-132733278 GGAGAGAGCAGGCAGTAAGAAGG + Intronic
1091286676 11:134412066-134412088 GGAGGGCGCGGGCAGGGAGGCGG + Intergenic
1091566360 12:1651574-1651596 GGAGAGAGGAGGAAGGGAGAGGG - Intergenic
1091718135 12:2794566-2794588 GGGGAGCGCAGGCTGCGGGATGG - Intergenic
1091792622 12:3280503-3280525 GGTGGGGCCAGGCAGGGAGGAGG + Intronic
1093958834 12:25251081-25251103 AGCGAGCGCCGGCGGGGAGAAGG + Intergenic
1094063514 12:26340145-26340167 GGTGGGTGCATTCAGGGAGATGG - Exonic
1094166670 12:27450288-27450310 GGTGGGGGCAGGGAGGGAGGAGG - Intergenic
1095375281 12:41519929-41519951 GGTGAGCACAGAGAGGCAGATGG - Intronic
1095894339 12:47265465-47265487 GGGAAGTGGAGGCAGGGAGATGG - Intergenic
1096155500 12:49339332-49339354 GGTGAGTGGAGGGAGGGAAAAGG - Intergenic
1096254964 12:50057409-50057431 GGGCCTCGCAGGCAGGGAGACGG + Intergenic
1096792203 12:54052468-54052490 GGAGAGCCCAGGGAGGGAGCCGG - Intronic
1096834415 12:54340206-54340228 TGGGAGAGCAGGAAGGGAGAGGG + Intronic
1097170575 12:57110547-57110569 GGTGGGGGCAGGCGGGGAGGTGG + Intronic
1097174983 12:57137428-57137450 GGGGAGCAGAGGCAGGGGGATGG - Intronic
1100570015 12:95838495-95838517 GGTGTGAGCAGGGAAGGAGAGGG - Intergenic
1101101301 12:101396145-101396167 GGTGAGGTGAGGCAGGGAAAAGG + Intronic
1101125350 12:101627804-101627826 GGTGAGCGCAAGCCCAGAGAAGG + Intronic
1102483998 12:113243930-113243952 GGAGAATGTAGGCAGGGAGAGGG - Intronic
1102795276 12:115683794-115683816 GGAGAGAGCAAGCAGGGGGAGGG + Intergenic
1102856623 12:116299837-116299859 GGTGAGGGGAGGCAGAGAGAGGG + Intergenic
1103816068 12:123657498-123657520 CGTGAAGGCAGGCAGGGAGTAGG - Intronic
1103998411 12:124844647-124844669 GATGTGCGCACACAGGGAGAAGG + Intronic
1104272544 12:127294970-127294992 GAGGAGTGCAGGCAGAGAGAGGG - Intergenic
1104276001 12:127328456-127328478 GGTGAGGGCGGGGAGCGAGAGGG - Intergenic
1104626106 12:130356395-130356417 CGTGAGGCCAGGCAGGGAGGTGG + Intronic
1104876580 12:132039101-132039123 GCTGAGCACAGGCAAGGAGGGGG - Intronic
1105287959 13:19022771-19022793 GGAGAGGGCAGGGAGGGGGAGGG + Intergenic
1105411957 13:20177941-20177963 AGTGAGCACTGGCAGGGAGCAGG - Intergenic
1105566954 13:21558812-21558834 GGTGAGGGATGGCAGGGAGAAGG + Intronic
1108313563 13:49218166-49218188 TGTGAGAGCAGGCAAGGAGTAGG + Intergenic
1108682358 13:52790891-52790913 GGGGAGGGGAGGCAGGGGGAGGG - Intergenic
1108682372 13:52790916-52790938 GGGGAGGGGAGGCAGGGGGAGGG - Intergenic
1111233436 13:85375142-85375164 GGTGAGAGAAGGTAGGAAGAGGG + Intergenic
1113271461 13:108679280-108679302 GGTGAGTGGAGACAGTGAGAGGG - Intronic
1113677062 13:112214749-112214771 GGTGAGGGCTGGAAGGGAGGAGG + Intergenic
1114080435 14:19198571-19198593 CATGGGCTCAGGCAGGGAGATGG - Intergenic
1114183651 14:20384353-20384375 GGTGACCAGAGGCATGGAGAGGG - Intronic
1114214397 14:20645090-20645112 CCTGAGGGCAGGGAGGGAGAAGG + Intergenic
1114402914 14:22426426-22426448 GGGGAGAGGAGGCAGGGGGAAGG - Intergenic
1117246365 14:53890489-53890511 GAAGAGAGCAGGAAGGGAGAAGG + Intergenic
1117253522 14:53956511-53956533 GGTGAGGGGAGACAGGCAGAGGG - Intronic
1119616184 14:76100619-76100641 GGTGCGGGCAGGCTGGGAGCTGG - Intergenic
1119758830 14:77137502-77137524 TGTGAGCACAGGCAGGTGGAGGG - Intronic
1119911201 14:78350752-78350774 TCTGAGCTCAGGCAGTGAGATGG + Intronic
1121008799 14:90507773-90507795 GACCAGGGCAGGCAGGGAGAGGG - Intergenic
1121117979 14:91356945-91356967 GGTGAGAAAAGGCGGGGAGAAGG + Intronic
1121309405 14:92927239-92927261 TGTGAACACAGGCATGGAGATGG + Intronic
1122268181 14:100556450-100556472 GGCCAACCCAGGCAGGGAGATGG + Intronic
1122612155 14:102992517-102992539 TGTCAGCGCAGGCTGGGAGGCGG - Intronic
1122914578 14:104852309-104852331 GGTGAACGAAGGCACTGAGAGGG - Intergenic
1122915403 14:104856067-104856089 TGGGAGAGCAGCCAGGGAGAGGG + Intergenic
1123031595 14:105454375-105454397 GGTGAGAGGAGGCTGGGACATGG + Intronic
1123180531 14:106466065-106466087 GGAGAGAGTTGGCAGGGAGAGGG - Intergenic
1202946368 14_KI270726v1_random:30598-30620 GGAGAGAGTTGGCAGGGAGAGGG + Intergenic
1123456388 15:20430273-20430295 GGTGTGGGCAGGAAGGGAGGAGG - Intergenic
1123472927 15:20568279-20568301 GGTGGGGGCAGAGAGGGAGATGG + Intergenic
1123645078 15:22432074-22432096 GGTGGGGGCAGAGAGGGAGATGG - Intergenic
1123661677 15:22570084-22570106 GGTGTGGGCAGGAAGGGAGGAGG + Intergenic
1123665564 15:22607758-22607780 GGGGTGGGCAGGCAGGAAGAGGG - Intergenic
1123665614 15:22607979-22608001 GGTGGGCGCAGGCAGCGGCATGG - Intergenic
1123666369 15:22611849-22611871 GGTGGGGGCAGAGAGGGAGAGGG - Intergenic
1123751362 15:23360646-23360668 GGTGGGGGCAGAGAGGGAGAGGG + Intronic
1123752143 15:23364673-23364695 GGTGGGCGCAGGCAGCGGCATGG + Intronic
1123752192 15:23364894-23364916 GGGGTGGGCAGGCAGGAAGAGGG + Intronic
1124229628 15:27932492-27932514 GGTGGGGGCAGGCAGAGATAAGG + Intronic
1124262525 15:28205425-28205447 GGTGTGGGCAGGAAGGGAGGAGG - Intronic
1124283733 15:28384564-28384586 GGTGGGGGCAGAGAGGGAGATGG + Intronic
1124298964 15:28527049-28527071 GGTGGGGGCAGAGAGGGAGATGG - Intronic
1124315476 15:28664317-28664339 GGTGTGGGCAGGAAGGGAGGAGG + Intergenic
1124319395 15:28702172-28702194 GGTGTGGGCAGGCAGGAAGAGGG - Intronic
1124319439 15:28702393-28702415 GGTGGGCGCAGGCAGCGGCATGG - Intronic
1124320188 15:28706263-28706285 GGTGGGGGCAGAGAGGGAGAGGG - Intronic
1124340603 15:28887003-28887025 GGTGTGCCCAGGCGGGGAGGGGG + Intronic
1124482325 15:30089154-30089176 GGTGGGGGCAGAGAGGGAGAGGG + Intronic
1124483077 15:30093038-30093060 GGTGGGCGCAGGCAGCGGCATGG + Intronic
1124483124 15:30093259-30093281 GGGGTGGGCAGGCAGGAAGAGGG + Intronic
1124488783 15:30141256-30141278 GGTGGGGGCAGAGAGGGAGAGGG + Intronic
1124489573 15:30145327-30145349 GGGGTGGGCAGGCAGGAAGAGGG + Intronic
1124520506 15:30404180-30404202 GGTGGGCGCAGGCAGCGGCATGG - Intronic
1124537407 15:30558165-30558187 GGTGGGGGCAGAGAGGGAGAGGG + Intronic
1124538151 15:30562039-30562061 GGTGGGCGCAGGCAGCGGCATGG + Intronic
1124543866 15:30610220-30610242 GGTGGGGGCAGAGAGGGAGAGGG + Intronic
1124544617 15:30614100-30614122 GGTGGGCGCAGGCAGCGGCATGG + Intronic
1124544665 15:30614321-30614343 GGGGTGGGCAGGCAGGAAGAGGG + Intronic
1124563820 15:30797653-30797675 GGTGGGGGCAGAGAGGGAGAGGG + Intergenic
1124564572 15:30801529-30801551 GGTGGGCGCAGGCAGCGGCATGG + Intergenic
1124637492 15:31374307-31374329 GGTGGGAACTGGCAGGGAGAGGG + Exonic
1124753954 15:32393000-32393022 GGGGTGGGCAGGCAGGAAGAGGG - Intronic
1124754002 15:32393221-32393243 GGTGGGCGCAGGCAGCGGCATGG - Intronic
1124754745 15:32397067-32397089 GGTGGGGGCAGAGAGGGAGAGGG - Intronic
1124760502 15:32445546-32445568 GGTGGGCGCAGGCAGCGGCATGG - Intronic
1124761249 15:32449422-32449444 GGTGGGGGCAGAGAGGGAGAGGG - Intronic
1124777385 15:32599641-32599663 GGTGGGGGCAGAGAGGGAGAGGG + Intronic
1124778134 15:32603516-32603538 GGTGGGCGCAGGCAGCGGCATGG + Intronic
1124959441 15:34383588-34383610 GGTGGGGGCAGAGAGGGAGATGG - Intronic
1124976067 15:34529809-34529831 GGTGGGGGCAGAGAGGGAGATGG - Intronic
1125500918 15:40239955-40239977 GGTGGGCGCAGGCCCTGAGATGG + Intronic
1125511035 15:40292382-40292404 GAAGAGCGCAGGCATGGTGAGGG + Exonic
1126887068 15:53162612-53162634 GGAGAGAGCAAGAAGGGAGATGG - Intergenic
1127490021 15:59453751-59453773 GAAGAGAGGAGGCAGGGAGAAGG + Intronic
1128063268 15:64748461-64748483 GGTGAACGCAGCATGGGAGATGG + Exonic
1128226047 15:66001953-66001975 GGTCAGGGCTGGCAGGGGGATGG + Intronic
1128243463 15:66117259-66117281 GGAGAGTTCTGGCAGGGAGATGG - Intronic
1128374730 15:67066502-67066524 GGAGAGCGCGGGCAGGAAGGGGG + Intronic
1128764152 15:70240849-70240871 AGTGGGCACAGGCCGGGAGATGG + Intergenic
1128904504 15:71455000-71455022 GGTGGGCATAGGAAGGGAGAGGG - Intronic
1129181753 15:73882148-73882170 AGTGGGCACAGGCAGGGAGTGGG - Intronic
1129493108 15:75948807-75948829 TGGGAGCCCAGGCAGGAAGACGG + Intronic
1129604497 15:77018270-77018292 GGGGAGCGCAGGCAGGAAGCAGG + Intronic
1129871693 15:78945373-78945395 GGTGGGGACACGCAGGGAGATGG - Intronic
1129871722 15:78945466-78945488 GGTGAAGACAGGCAGGGACATGG - Intronic
1129871729 15:78945498-78945520 GGTGGGGACAGGCAGGGAGATGG - Intronic
1129871749 15:78945561-78945583 GGTGGGCACATTCAGGGAGATGG - Intronic
1129871773 15:78945624-78945646 GGTGGGGACAGGCAGGGACATGG - Intronic
1129871796 15:78945688-78945710 GTTGGGGACAGGCAGGGAGATGG - Intronic
1129871807 15:78945720-78945742 GGTGGGGACAGGCAGGGAGATGG - Intronic
1129871855 15:78945879-78945901 GGTGGGGACAGGCAGGGAGATGG - Intronic
1129871885 15:78945974-78945996 GGTGGGGATAGGCAGGGAGATGG - Intronic
1129871945 15:78946161-78946183 GGTGGGGACAGGCAGGAAGATGG - Intronic
1129871963 15:78946225-78946247 GGTGGGGACAGGCAGGGAGATGG - Intronic
1130773150 15:86945427-86945449 GGGGAGCCGAGGCAGGTAGACGG + Intronic
1130793757 15:87186892-87186914 AGGGGGCGGAGGCAGGGAGAAGG - Intergenic
1131282874 15:91034841-91034863 GGTGGGGGCAGAGAGGGAGATGG - Intergenic
1132410797 15:101577101-101577123 GGTGGGGGCAGAGAGGGAGAAGG - Intergenic
1132433072 15:101776038-101776060 GGTGGGGGCAGAGAGGGAGATGG - Intergenic
1132475048 16:130857-130879 GGTTAGCACAGGCTGGGAGCAGG + Intronic
1132571648 16:646869-646891 CGTGGGGGCAGCCAGGGAGAGGG + Intronic
1132591450 16:728029-728051 GGTGAGCGCCGGCGGGGCGCGGG + Exonic
1133097875 16:3459332-3459354 AGTGTTCACAGGCAGGGAGAGGG + Intronic
1133301871 16:4787602-4787624 TGCGAGGACAGGCAGGGAGAGGG + Exonic
1134056667 16:11174439-11174461 GGTGAGGCCAGACAGGGAGCAGG - Intronic
1134084590 16:11347667-11347689 GCTGAGGGCAGGCAGACAGAGGG - Intronic
1134208034 16:12253578-12253600 TGTGAACACAGGCAGGGGGATGG + Intronic
1134609562 16:15597665-15597687 GGTCAGCCTAGGCAGGGAGCTGG - Intronic
1135526939 16:23220422-23220444 GGTGAGTGGAGGAAGAGAGAGGG - Intergenic
1135860494 16:26051663-26051685 GATGAGAGGAGGGAGGGAGAGGG - Intronic
1136076695 16:27822094-27822116 GGGGGGCGGGGGCAGGGAGAGGG + Intronic
1136628817 16:31477485-31477507 GGTGAGCGGGCGCAGGCAGAAGG - Exonic
1137257578 16:46789905-46789927 GGTGGGCGGTGGCAGGCAGAGGG - Intronic
1137448512 16:48548755-48548777 GCTGAGCCCAGGCAGGTGGAGGG + Intronic
1137628413 16:49924015-49924037 GGACAGCGCAGGCAAGGAGCAGG - Intergenic
1137676376 16:50305695-50305717 GGTGGCAGCAGGCAGGGGGAAGG - Intronic
1139290641 16:65855274-65855296 GGTGAGTGCAGCTAGGGAGCAGG - Intergenic
1139405337 16:66713211-66713233 ATTGAGCAGAGGCAGGGAGAAGG + Intergenic
1139437534 16:66944940-66944962 GAAGAGAGAAGGCAGGGAGAAGG - Exonic
1139469637 16:67171161-67171183 GGTGGGCAAAGGAAGGGAGAGGG - Exonic
1139486532 16:67259946-67259968 GGTGAGAGCAGGCAGGCATCAGG + Exonic
1139749528 16:69100934-69100956 GGTGAGCACAGGCAGTGACAAGG - Intergenic
1139946933 16:70648022-70648044 GGTGAGGCCAGGCTGGGAGCTGG + Intronic
1140772533 16:78218023-78218045 GGCAAGCACAGGGAGGGAGAGGG - Intronic
1141238888 16:82246041-82246063 AGTGAGCCCAGGCTGGGTGAGGG + Intergenic
1141290416 16:82713448-82713470 GCTGGGGGCAGGCAGGGAAAGGG - Intronic
1141883780 16:86878323-86878345 GGGGAACGCAGGCGGGGAAAGGG - Intergenic
1142031059 16:87838859-87838881 AGTGAGCACAGGGAGGGCGAGGG - Intronic
1142150516 16:88510619-88510641 GGTGAGCCCAGCCAGGGGAATGG - Intronic
1142224111 16:88869318-88869340 GCTGTGCGGAGCCAGGGAGAGGG - Intergenic
1142229709 16:88894111-88894133 GGTGAGTGGAGGCAGGGAAATGG - Intronic
1142288573 16:89182097-89182119 GGGGAGGGCAGGCTGGGGGAGGG - Intronic
1142288580 16:89182112-89182134 GGGGAGGGCAGGCTGGGGGAGGG - Intronic
1142288595 16:89182142-89182164 GGGGAGGGCAGGCTGGGGGAGGG - Intronic
1142288610 16:89182172-89182194 GGGGAGGGCAGGCTGGGGGAGGG - Intronic
1142288617 16:89182187-89182209 GGGGAGGGCAGGCTGGGGGAGGG - Intronic
1142288632 16:89182217-89182239 GGGGAGGGCAGGCTGGGGGAGGG - Intronic
1142288639 16:89182232-89182254 GGGGAGGGCAGGCTGGGGGAGGG - Intronic
1142288646 16:89182247-89182269 GGGGAGGGCAGGCTGGGGGAGGG - Intronic
1142288660 16:89182277-89182299 GGAGAGGGCAGGCTGGGGGAGGG - Intronic
1142288667 16:89182292-89182314 GGAGAGGGCAGGCTGGGAGAGGG - Intronic
1142288672 16:89182307-89182329 GGGGAGGACAGGCTGGGAGAGGG - Intronic
1142305035 16:89280116-89280138 GGGAAGCTCCGGCAGGGAGAAGG + Exonic
1142592615 17:1012953-1012975 GGTGTGGGCAGGAGGGGAGAGGG + Intronic
1142607850 17:1091800-1091822 GGTGAGCACGGGCTGGGAGGTGG + Exonic
1142685622 17:1575484-1575506 CGTGAACGCTGGCACGGAGACGG + Exonic
1142904093 17:3031341-3031363 GGTGAGCTCAGGAAGGGACTGGG - Intronic
1142904148 17:3031580-3031602 GGTGAGCTCAGGAAGGGATTCGG - Intronic
1142904182 17:3031739-3031761 GGTGAGCTCAGGAAGGGATTCGG - Intronic
1142904219 17:3031898-3031920 GGTGAGCTCAGGAAGGGATTCGG - Intronic
1142928202 17:3259614-3259636 GGTGGGCTGAGGCAGAGAGAGGG + Intergenic
1143050084 17:4118102-4118124 GGAGAGAGAAGGCAGGGTGACGG + Intronic
1143682376 17:8486992-8487014 GGTGTGAGCAGGCAGGCAGGGGG - Intronic
1144024941 17:11269407-11269429 GGTCAGCGCAGCCAGGGACTGGG + Intronic
1144239617 17:13297496-13297518 GGAGAGTGCAGACAGGAAGAAGG + Intergenic
1144877652 17:18410859-18410881 GGGGAGCGGAGGGAGGGAGAAGG - Intergenic
1144890110 17:18489600-18489622 GCTGAGGGCAGGCTGGCAGAGGG - Intronic
1144891061 17:18494618-18494640 GGCGGGCACAGCCAGGGAGAGGG + Exonic
1144950901 17:18992877-18992899 TGTGTGGGGAGGCAGGGAGAGGG - Intronic
1145141162 17:20449700-20449722 GGCGGGCACAGCCAGGGAGAGGG - Intronic
1145142106 17:20454717-20454739 GCTGAGGGCAGGCTGGCAGAGGG + Intronic
1145154580 17:20533544-20533566 GGGGAGCGGAGGGAGGGAGAAGG + Intergenic
1145275232 17:21425100-21425122 GGTGGGAGCAGCCAGGCAGATGG + Intergenic
1145278994 17:21454978-21455000 GGGGAGGGGAGGGAGGGAGAAGG - Intergenic
1145313085 17:21710997-21711019 GGTGGGAGCAGCCAGGCAGATGG + Intergenic
1145711508 17:26982811-26982833 GGTGGGAGCAGCCAGGCAGATGG + Intergenic
1146627622 17:34446195-34446217 GGTGGGGAAAGGCAGGGAGATGG + Intergenic
1147000461 17:37358894-37358916 GGTGAGCGGAGGCTGGGAGGCGG + Intronic
1147250589 17:39150892-39150914 GGTGGGAGCAGCCAGGGGGATGG - Intronic
1147370892 17:39992299-39992321 AGGGAGCGCAGGGAGAGAGAGGG + Intronic
1147587283 17:41659762-41659784 GAGGAGCGAAGGCAGGGAGGTGG + Intergenic
1147847707 17:43416694-43416716 GGGGGGCACAGGCAGGGAAAAGG - Intergenic
1147927191 17:43953274-43953296 GGTGAGCGCAGGCGCGGAGCGGG - Exonic
1148463683 17:47851850-47851872 GGTGGGCAGAGGCTGGGAGAGGG - Intronic
1148493504 17:48037914-48037936 GGTGAGGGCGGGAGGGGAGATGG - Intronic
1148738773 17:49880385-49880407 GCTGAGGGGTGGCAGGGAGAAGG - Intergenic
1149566054 17:57641413-57641435 GGAGAAAGCAGGCATGGAGAAGG + Intronic
1149651537 17:58279275-58279297 GGTGAGCGCCGGCGGGCAGAGGG - Exonic
1150802240 17:68291454-68291476 GCTGAGCGCAGCCAAGGAGGGGG + Intronic
1151559852 17:74864392-74864414 GGGAAGGGCATGCAGGGAGAGGG - Intronic
1151679389 17:75615600-75615622 GGTGAGCGCTGGCAGGGCCCTGG + Intergenic
1152068443 17:78123864-78123886 GATGAGAGCAGACAGGTAGATGG + Intronic
1152139604 17:78528726-78528748 GGTGTGTGCAGGCTGGGCGAGGG - Intronic
1152494839 17:80663754-80663776 GGTGAGCTCAGGAAGACAGAGGG - Intronic
1152517921 17:80836994-80837016 GATGAGAGCAGGCAGGGAAAGGG + Intronic
1152735831 17:81996343-81996365 GGTGAGCCTGGGCCGGGAGAGGG + Intronic
1153849152 18:9077175-9077197 GGTGAGGGGAGTGAGGGAGAAGG + Intergenic
1154326354 18:13393625-13393647 AGAGAACGGAGGCAGGGAGACGG - Intronic
1157580517 18:48771533-48771555 GGTGAGGGCATGCAGGGAAGGGG - Intronic
1157656699 18:49396909-49396931 GGGTAGGACAGGCAGGGAGAGGG + Intronic
1157763550 18:50281895-50281917 GGAGAGCGCCGGCAGGGCCAGGG - Intergenic
1157818966 18:50751573-50751595 GGTTGGGGGAGGCAGGGAGAGGG + Intergenic
1159485514 18:69050987-69051009 GGTAAGCTGAGGCAGGAAGATGG - Intronic
1161030278 19:2054905-2054927 GCTGAGTGCTGGCAGGGAGTGGG - Intergenic
1161098598 19:2408654-2408676 AGTGAGCTCAGGCAGGCAGGCGG + Intronic
1161150296 19:2704034-2704056 GAGGAGGGCAAGCAGGGAGATGG - Intergenic
1161262345 19:3344984-3345006 GGCGAGGGCAGGGAGGGACAGGG + Intergenic
1161572920 19:5040182-5040204 GGTCAGCCCAGGCCGGGAGAGGG - Intronic
1161739393 19:6011334-6011356 GGTGGGGGCAGGGAGGGAGCCGG + Intronic
1161803229 19:6427211-6427233 GGTGAAGTCAGGCAGGGATATGG - Exonic
1161806211 19:6444439-6444461 GGTGAGGGGACGCAGGGAAAGGG - Intronic
1162552275 19:11364476-11364498 GGTGGGCGCTGGCAGGGGTAGGG - Exonic
1162845759 19:13391282-13391304 TGTGAACCCAGGAAGGGAGAAGG - Intronic
1163666885 19:18607459-18607481 GGACAGCGCAGCCAGGGCGAAGG - Exonic
1164156304 19:22599624-22599646 GGAGAGGGCAGAGAGGGAGATGG + Intergenic
1164864569 19:31593151-31593173 GGAGAGGCCAGGAAGGGAGAGGG + Intergenic
1165076527 19:33282639-33282661 TGTGAGGTCAGGGAGGGAGAGGG - Intergenic
1165113617 19:33515780-33515802 AGTGTGGCCAGGCAGGGAGAGGG - Intronic
1165256385 19:34579262-34579284 TGTGAGCGGTGGCAGAGAGAAGG + Intergenic
1165315012 19:35049436-35049458 GGTGAGGGCAGGCAGGCTGGAGG - Intronic
1165396859 19:35569244-35569266 GGGAAGCACAGGCAGGGAGGTGG - Intergenic
1165489066 19:36112964-36112986 GGTGAGCAGTGGCAGGGACAGGG + Exonic
1165591554 19:36973518-36973540 GCCGCGCGCAGGCAGGGAGTGGG + Intronic
1165843835 19:38805575-38805597 GGTGGGTGGAGGCAGGCAGAGGG - Intronic
1165863483 19:38921682-38921704 GGTGGGCTCAGCCCGGGAGAGGG + Intronic
1166147966 19:40850225-40850247 GGTGTCCCAAGGCAGGGAGATGG - Exonic
1166170990 19:41027521-41027543 GGTGTCCCAAGGCAGGGAGATGG - Intergenic
1166178060 19:41088651-41088673 GGTGTCCTAAGGCAGGGAGATGG + Exonic
1167643017 19:50692489-50692511 GGTGATCTGAGGCAGGGAGGGGG + Intronic
1167665490 19:50820960-50820982 GGTGGGGGCAGGTAGGGAGGAGG + Intronic
1167782159 19:51605820-51605842 GGTCAGCACTTGCAGGGAGAGGG - Intergenic
1168482645 19:56734701-56734723 GGTGAGAGCAGGCAGGATGAGGG + Intergenic
925425279 2:3744230-3744252 GGTGAGAGCAGAGAGGGACAGGG + Intronic
925667580 2:6277088-6277110 GGTGAGGGAGGGCAGGGGGAGGG + Intergenic
927459608 2:23286628-23286650 GGTGAAGGAAGCCAGGGAGAAGG + Intergenic
927611407 2:24544916-24544938 GGTAACCACAGGCAGGAAGAAGG + Intronic
928089592 2:28366089-28366111 GGTGAGGCCAGGCTGGGATATGG + Intergenic
928549495 2:32357227-32357249 GCTGAGCGCAGGCCGGAAGATGG + Exonic
928600649 2:32900769-32900791 GGTGAGCCGAGGCATGGAGGTGG + Intergenic
929611677 2:43275454-43275476 GGACAGGGCAGGCAGGGGGATGG - Intronic
930362656 2:50401456-50401478 GGTGAGAGCGGGGAGGGAGAGGG + Intronic
930589588 2:53311732-53311754 GGAGAGAGAAGGAAGGGAGAAGG - Intergenic
930873672 2:56191096-56191118 GATGATCCCAGGCAGGGAGAGGG - Intronic
930914684 2:56672436-56672458 AGTGAGCTTAGGCAGGGAGCTGG + Intergenic
930942368 2:57028169-57028191 GGTGTGCTCAGGCATGGGGATGG + Intergenic
931694368 2:64860479-64860501 GGGGAGCGCAGGCAGGGTGGAGG - Intergenic
932583608 2:73008522-73008544 GGAGAGGGCAGGCAGGACGAGGG + Intronic
933746830 2:85577842-85577864 GGTCAGGGGAGGGAGGGAGAAGG - Intronic
933966362 2:87432573-87432595 GGTGAGGGCAGGCACTGAGTGGG + Intergenic
934013757 2:87855624-87855646 GGGGTGGGCAGGCAGGGAGATGG + Intergenic
935059009 2:99592245-99592267 GGTGAGTCCAGGGAGTGAGAAGG - Intronic
935558544 2:104537444-104537466 GGTGATTGCAGGCAGGAGGAGGG - Intergenic
936327433 2:111517912-111517934 GGTGAGGGCAGGCACTGAGTGGG - Intergenic
936371535 2:111905876-111905898 GGAGGTGGCAGGCAGGGAGAAGG + Intronic
936516619 2:113185284-113185306 GGAGAGGCCAGGCAGGGAGAAGG - Intronic
937340278 2:121086755-121086777 GCTGTGCCCAGGCTGGGAGAGGG - Intergenic
937810857 2:126197326-126197348 GGTAAGGGCAGCCAGAGAGATGG + Intergenic
938728320 2:134126162-134126184 GGTGAGGGCAGGAAAGGAAACGG - Intronic
938945773 2:136210811-136210833 GGGGAGTGCAGAGAGGGAGAAGG + Intergenic
939899739 2:147837695-147837717 GGTGTTGGCAGGCACGGAGAAGG - Intergenic
941274841 2:163478289-163478311 GGGGAGTGGAGGCAGGGAGGAGG - Intergenic
941856096 2:170232590-170232612 TTTGAACCCAGGCAGGGAGAAGG - Intronic
942512398 2:176716474-176716496 TGTGAGAGCAGGCAGGTAAAAGG + Intergenic
942649363 2:178150376-178150398 GGTGAGGGCAGGTAGGGGGAAGG + Intergenic
944359629 2:198837912-198837934 GTTGAATGAAGGCAGGGAGAGGG + Intergenic
945187322 2:207152544-207152566 GCTAAGCCCAGGCAGGGGGAGGG + Intronic
946199758 2:218064812-218064834 GGGGAGGGCAGGCAGGCAGGCGG - Intronic
946863120 2:224018921-224018943 GGGCAGTGCAGGCAGAGAGATGG - Intronic
946864832 2:224033598-224033620 GGAAAGAGCAGGCTGGGAGAGGG - Intronic
948005852 2:234607013-234607035 GGTGAGCACAGCCTGGCAGATGG - Intergenic
948514872 2:238497672-238497694 GGAGAGAGCACGCAGGGAGTGGG + Intergenic
948657645 2:239486590-239486612 GGTCCGAGCAGGTAGGGAGAGGG - Intergenic
948720132 2:239894189-239894211 GCTGAGGACAGGCAGGGAGAAGG - Intronic
948871947 2:240805097-240805119 GGAGAGGGGAGGGAGGGAGAGGG + Intronic
1168797387 20:620624-620646 GGAGAACGCAGGCTGGGAGGGGG + Intergenic
1168968364 20:1913857-1913879 GGGGAGCCCAGACAGGAAGAGGG - Intronic
1169278026 20:4246567-4246589 GGGGAGGGCAGAGAGGGAGATGG + Intronic
1169388708 20:5172249-5172271 GGTCAGCGCTGAGAGGGAGAAGG + Intronic
1169758481 20:9067811-9067833 GGTGGCCGCCGGCCGGGAGAAGG + Intergenic
1170429791 20:16265508-16265530 GTCGTGCTCAGGCAGGGAGAGGG - Intergenic
1170686751 20:18576243-18576265 GGTGGGTGGAGGCAGGGTGAAGG - Intronic
1170964001 20:21050381-21050403 GGTGATCGCTGGAAGGGAAAAGG - Intergenic
1170978313 20:21187558-21187580 GGTGAGCGGATTCAGGGAGAAGG - Intronic
1172100943 20:32483669-32483691 GGGGAGCGCAGGGAGGGCGCAGG + Intronic
1172170269 20:32926114-32926136 GGTGAGAGCAGGTAGGGTGAAGG - Intronic
1172306518 20:33884629-33884651 GGTGATGGCAGGCAGGGACGGGG - Intergenic
1172460729 20:35116411-35116433 GGTGAGGGCAGGAAGGGAGCAGG - Intronic
1172620354 20:36314264-36314286 GGAGAGTGCAGGCGGGGACAAGG + Intronic
1172967490 20:38847727-38847749 TGTGAGAGGAGACAGGGAGAAGG + Intronic
1173147298 20:40535706-40535728 GGTGAGGCCAGGAAGGGAGGTGG - Intergenic
1173339636 20:42141692-42141714 AGAGGGAGCAGGCAGGGAGATGG - Intronic
1173620277 20:44431005-44431027 GGTGAGGGCGGGGAGGGAGGAGG - Exonic
1173924504 20:46770790-46770812 GGTGGGACCCGGCAGGGAGAAGG + Intergenic
1173983311 20:47241543-47241565 AGTGAGGGCAGGCAGGGAGGAGG + Intronic
1174102391 20:48137583-48137605 GGTGGGCACAGGCTGGGATATGG - Intergenic
1174380648 20:50153479-50153501 GGTGACCGCAGGCCTGGAGGGGG + Intronic
1174393039 20:50229617-50229639 GCTGAGCAGAGGCAAGGAGAGGG - Intergenic
1174984179 20:55431550-55431572 GGTGAGAGCTGGGAGAGAGAGGG + Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175502762 20:59461969-59461991 AGTGTGGGAAGGCAGGGAGATGG - Intergenic
1175945478 20:62556569-62556591 GGGGAGAGCAGGCAGGGCGGGGG + Intronic
1176099897 20:63360205-63360227 GGCCAGCCCAGGCAGGAAGAGGG + Intronic
1176195869 20:63836143-63836165 GGAGAGCGCAGGCAGGGCAGGGG + Intergenic
1176195938 20:63836333-63836355 GGAGAGCGCAGGCAGGGCAGGGG + Intergenic
1176222558 20:63976972-63976994 GGTGATGGCATGCTGGGAGAAGG + Exonic
1176240242 20:64072526-64072548 TGTGAGGGCAGGTGGGGAGAGGG + Intergenic
1178060475 21:28848907-28848929 GCAGAGCGCAGGCAGGGGCAGGG - Intergenic
1179243842 21:39613097-39613119 GGGGAGCGCTGGCCGGGAGCGGG + Intronic
1179990075 21:44943448-44943470 GGTGATTGAAGGCAGGGAGCAGG + Intronic
1180051291 21:45332088-45332110 GCTGAGAGCAGGCAGTGGGAGGG + Intergenic
1180051304 21:45332123-45332145 GCTGAGAGCAGGCAGGGGGAAGG + Intergenic
1180051314 21:45332147-45332169 GCTGAGAGCGGGCAGGGGGAGGG + Intergenic
1180154677 21:45972215-45972237 GGTGTGGTCAGGCAGAGAGACGG + Intergenic
1180858720 22:19064543-19064565 GCTGAGCGCAGGCAGGGGGCTGG - Intronic
1180995555 22:19963517-19963539 GGTGAGCACAGGTGGAGAGAGGG - Intronic
1181284115 22:21739819-21739841 GGTGAGGGCAGGTGGGGAAATGG - Intergenic
1181328534 22:22070397-22070419 AGTCAGCACAGGCTGGGAGAGGG - Intergenic
1181329118 22:22075356-22075378 AGTCAGCACAGGCTGGGAGAGGG - Intergenic
1181341391 22:22182575-22182597 AGTCAGCACAGGCTGGGAGAGGG - Intergenic
1181358751 22:22318902-22318924 AGTCAGCACAGGCTGGGAGAGGG - Intergenic
1181361811 22:22343410-22343432 AGTCAGCACAGGCTGGGAGAGGG - Intergenic
1181372231 22:22427716-22427738 AGTCAGCACAGGCTGGGAGAGGG - Intergenic
1181472548 22:23149836-23149858 GGCGAGCCCAGGCAGGGACTTGG - Intronic
1181844369 22:25694754-25694776 GGTCAGGGGAGGCAGGGAAAGGG - Intronic
1182718212 22:32376849-32376871 AGTCAGCACAGGCTGGGAGAGGG - Intronic
1183097366 22:35561164-35561186 GGAAAGAGAAGGCAGGGAGAAGG - Intergenic
1183303306 22:37069134-37069156 GGAGCGCGCGGGCAGGCAGACGG + Exonic
1183395036 22:37566705-37566727 GTTGAGCTGGGGCAGGGAGATGG - Exonic
1183398519 22:37587308-37587330 GGAGAGGGGAGTCAGGGAGAGGG + Intergenic
1183522398 22:38303116-38303138 GGTGAGCGCAGGGTGGGCGGCGG - Exonic
1183649521 22:39145868-39145890 GGTGAGGGCACGCAGTGGGAAGG + Intronic
1184340259 22:43881942-43881964 AGGAAGCGCAGGGAGGGAGAGGG + Intronic
1184536516 22:45091358-45091380 GCAGAGCTCAGGCAGGGAGGTGG + Intergenic
1185150499 22:49161216-49161238 GGGGAGGCCATGCAGGGAGAGGG - Intergenic
1185207522 22:49548679-49548701 GGTGAGAGCAGCCAGGATGAGGG - Intronic
1185212424 22:49577729-49577751 GGAGAGCGCTGGCTGGGAGGAGG - Intronic
949537089 3:5004648-5004670 GGTGGGTGGAGGAAGGGAGAAGG + Intergenic
949986637 3:9546393-9546415 GGTGGGAGGAGGCAGGTAGAGGG - Intronic
950425553 3:12923109-12923131 GGAGAGGGCAAGCAGGGAGCAGG + Intronic
950706518 3:14785829-14785851 GGAGAGCGGAGGCAGGAAGGTGG - Intergenic
950936239 3:16842457-16842479 GGTGAGCAGAAGTAGGGAGAGGG + Intronic
951097333 3:18647236-18647258 GGTGAATGGAGGCAGGGAGTGGG + Intergenic
951755349 3:26085389-26085411 GGAGAGAGGAGGCAGAGAGAAGG - Intergenic
953665172 3:44920674-44920696 GCTGAGCTCAGTCAGAGAGAAGG + Intronic
954431715 3:50474171-50474193 GGTGACTGCTGGGAGGGAGAGGG + Intronic
955492752 3:59499489-59499511 GAGGAGGGCAGGCAGGGAGAGGG + Intergenic
955929968 3:64046607-64046629 GGTGGGAGCAGGCAGGGAGATGG + Intergenic
960877014 3:122307208-122307230 GGTGGAGGAAGGCAGGGAGAAGG - Intergenic
961630692 3:128296293-128296315 GGTGAGTGGAGGCAGGAGGAAGG + Intronic
961967172 3:130917810-130917832 GGTTAGCAGAGGCTGGGAGAAGG - Intronic
962336598 3:134537430-134537452 TGTGAGGGCAGGCGGGAAGAAGG - Intronic
962432185 3:135329758-135329780 GGTGAGGGAAGCCAGAGAGAAGG - Intergenic
962807518 3:138938018-138938040 GGTGAGGGGAGGGAGCGAGAAGG + Intergenic
962894814 3:139704708-139704730 GGAGAGAGAAGGCAGGGAGAAGG + Intergenic
962968335 3:140374989-140375011 GGTGAGCAAAGGAAGGGAGAAGG - Intronic
962984261 3:140520437-140520459 AGTCAGTGCAGGCAGGGAAAAGG + Intronic
963162765 3:142168835-142168857 GGTGAGAGCAAGAAGGGAGTGGG - Intronic
964643241 3:158931819-158931841 GGTGGGGGCATGCAGGGAGGTGG + Intergenic
966378771 3:179323115-179323137 GGGGCGCGCGGGGAGGGAGAGGG + Intronic
966913400 3:184571596-184571618 GGGGGGCACAGGCAGGCAGAGGG - Intronic
967828146 3:193895350-193895372 GGAGAGGGCAGGCAGGGATCAGG - Intergenic
968088073 3:195883118-195883140 GGAGGGGGCGGGCAGGGAGAGGG - Intronic
968123799 3:196144047-196144069 GGCGAAGGGAGGCAGGGAGAGGG - Intergenic
968453898 4:687705-687727 GGCGAGCGCAGGCAGGGTCGAGG - Intronic
968576999 4:1371645-1371667 GATGGCAGCAGGCAGGGAGAGGG + Intronic
968801418 4:2745696-2745718 GGTGGGCCTGGGCAGGGAGAAGG - Intronic
969596003 4:8149601-8149623 GGGGAGCGGGGGCAGGCAGAAGG + Intronic
969671348 4:8592036-8592058 GCTGAGTCCAGGCAGAGAGAGGG + Intronic
969717983 4:8877627-8877649 AGTGAGCCCAGGCAGGGAGAGGG - Intergenic
969720203 4:8889276-8889298 GGTTGGCGCAGGGAGGGAAATGG + Intergenic
969869241 4:10094496-10094518 GATGGGGGAAGGCAGGGAGATGG + Intronic
972245824 4:37244700-37244722 GGCGGGCGCGGGCGGGGAGATGG + Exonic
974295932 4:59999140-59999162 GGTTTGCACAGGGAGGGAGAGGG + Intergenic
975988860 4:80236049-80236071 GGAAAGAGCAGGGAGGGAGAGGG - Intergenic
976359957 4:84166204-84166226 TGTGAGGACACGCAGGGAGAAGG + Intergenic
976671823 4:87662376-87662398 GGGGAGAGCAGCCATGGAGACGG + Exonic
977510282 4:97953504-97953526 AGTTAACTCAGGCAGGGAGAAGG - Intronic
978431813 4:108640665-108640687 GCTGAGCAAAGGCAGAGAGATGG - Intergenic
979258269 4:118626293-118626315 GGGGAGCTGAGGCAGGAAGATGG + Intergenic
979330080 4:119414271-119414293 GGGGAGCTGAGGCAGGAAGATGG - Intergenic
979340133 4:119512920-119512942 GGTGAGATCATCCAGGGAGATGG + Intronic
980321009 4:131274989-131275011 GGTGAGGGCAGGCAGGGTGAAGG + Intergenic
981533836 4:145779005-145779027 GGTGGGAGCAGCCAGGGAAAAGG - Intronic
982375625 4:154687708-154687730 GGTGAGAGCAGGCAGGTGTAGGG + Intronic
983887582 4:172997637-172997659 GGTGAGTGGGGGCAGGGGGAAGG + Intronic
985406461 4:189643495-189643517 GGAGAGGGCAGGGAAGGAGAAGG - Intergenic
985835674 5:2270226-2270248 GGTGAGGGCAGGCAGAGGCAGGG + Intergenic
987117098 5:14734381-14734403 GGTGAGCGCACACATGGACAAGG - Intronic
987229992 5:15884143-15884165 CATGTGAGCAGGCAGGGAGATGG - Intronic
988483247 5:31646907-31646929 AGAGAGAGCAGGCAGTGAGATGG + Intronic
989607016 5:43254204-43254226 GGTGAGAGCAGGACGGGACATGG + Intronic
990523558 5:56603388-56603410 GGTGATAGTGGGCAGGGAGAAGG - Intronic
990805354 5:59654243-59654265 GGGGAGGGGAGGAAGGGAGAGGG + Intronic
992065078 5:73099645-73099667 GGGGAGCCGAGGCAGGCAGATGG - Intergenic
992368303 5:76115863-76115885 GCTGAGCAGAGCCAGGGAGAGGG - Intronic
993110143 5:83646704-83646726 GGTGAGGGAAGGCCTGGAGATGG + Intronic
993901350 5:93585678-93585700 GATGAGCGCAGGCCGGGAGGGGG - Intronic
994591515 5:101779157-101779179 GGAGAGGGGAGGGAGGGAGAAGG + Intergenic
995042574 5:107605764-107605786 GGTTGGGGCAGGCAGGGAAAAGG - Intronic
995153394 5:108879387-108879409 GGGGAGGGCCGGCAGGGTGAGGG - Intronic
996404345 5:123090835-123090857 GGTGAGGAGAGGGAGGGAGAGGG - Intronic
996762287 5:126998595-126998617 GGGGAGAACAGGCAGGGAGGTGG + Intronic
997614912 5:135239726-135239748 GAAGAGTGCAGGCATGGAGAAGG - Intronic
998155514 5:139784599-139784621 GGTGAGAGCAGGGAGGCAGCAGG - Intergenic
998715003 5:144873068-144873090 GATGAGAACAGCCAGGGAGAGGG + Intergenic
999122449 5:149219634-149219656 GGTGTGCACAGGAAGGGACAGGG - Intronic
999226744 5:150031919-150031941 GGTGAGTGAAGGCATGGAAAAGG - Intronic
999241735 5:150131902-150131924 GGACAGTGCAGGAAGGGAGAGGG + Intronic
999640003 5:153662950-153662972 GGTGAGAGCAGAGCGGGAGAGGG - Intronic
999833391 5:155342125-155342147 GGTGAGGGCAGACAAAGAGAGGG - Intergenic
1001485854 5:172119179-172119201 GGTCTGAGCAGGCAGGGAGCGGG + Intronic
1001554137 5:172624776-172624798 GGAGAGTGCAGGCTGGCAGATGG - Intergenic
1001960082 5:175874713-175874735 GGGGAGGGGAGGCAGAGAGAGGG + Intronic
1002029499 5:176417201-176417223 GCAAAGCGCAGGCAGGGAGGAGG - Intergenic
1002194302 5:177493889-177493911 ACTGAGCTGAGGCAGGGAGAGGG + Intronic
1002316415 5:178347089-178347111 GGTGAGGACAGGGAGGGAGGGGG - Intronic
1002781388 6:369561-369583 CGAGTGGGCAGGCAGGGAGAAGG - Intergenic
1003128601 6:3376410-3376432 GGTGGGGGCAGGCAGAGGGAAGG - Intronic
1003242834 6:4359314-4359336 GGGAAGAGCAGGGAGGGAGAGGG - Intergenic
1003251147 6:4430101-4430123 AGTGAGCACAGGTGGGGAGATGG + Intergenic
1003392917 6:5728878-5728900 GGTGAGCTCAGGCAGGGTTTCGG - Intronic
1003518480 6:6837166-6837188 GGAGAGGGCAGGAAGGAAGAAGG + Intergenic
1005040522 6:21595960-21595982 AGGGCGCGCAGGCAGGGAGAAGG + Exonic
1005946682 6:30600982-30601004 GGTGAGCCCACGCTGGGGGAGGG + Exonic
1006304502 6:33211222-33211244 GGAGAGCCCGGGGAGGGAGAAGG + Exonic
1006375569 6:33669991-33670013 GGTGAGGGCAAGATGGGAGAGGG - Intronic
1006385642 6:33729358-33729380 GCTGAGGGCAGGCACAGAGAGGG - Intronic
1006543273 6:34757669-34757691 GGTGGACGGAGGCAGGGAGATGG + Intronic
1006750817 6:36375780-36375802 GGGGGGCCCAGGGAGGGAGATGG - Intronic
1007115443 6:39339968-39339990 CGAGAGCCCAGGCAGGGAGAGGG + Intronic
1007506613 6:42340322-42340344 AGGGAGGGCAGGCAGAGAGAGGG + Intronic
1008487455 6:52051550-52051572 GGTGGGAGCAGGAAGGGAGAGGG - Intronic
1011084223 6:83521486-83521508 GGTGAGGGAAGGGAAGGAGAAGG - Intronic
1012444523 6:99294340-99294362 AGTGAACGCAGGCAGGCAGAGGG + Intronic
1012986938 6:105885274-105885296 GGTGAGGGAGGGGAGGGAGAGGG + Intergenic
1013298451 6:108781062-108781084 GGAGAGGGCAGGCATGGAGTGGG - Intergenic
1013569070 6:111402295-111402317 GGTGAGCACAGACTGGGAAATGG - Intronic
1015223872 6:130834261-130834283 GGTGGGGGCAGACAGAGAGAGGG + Intronic
1016261997 6:142182981-142183003 GGAGCGCGCAGCAAGGGAGAAGG + Intronic
1016665385 6:146633434-146633456 GGTGATCTAAGGCAGGGGGAGGG - Intronic
1017124373 6:151051867-151051889 GGAGGGCGCAGCCAGGGTGATGG - Intronic
1017815381 6:158012390-158012412 AGGGAGGCCAGGCAGGGAGAGGG + Intronic
1019009017 6:168826284-168826306 CCAGAGCGCAGGGAGGGAGACGG + Intergenic
1019070604 6:169341851-169341873 GGTGAGTGTGGCCAGGGAGAGGG - Intergenic
1019327446 7:445405-445427 GGTGAGGGCATGCAGGGTGATGG - Intergenic
1019616172 7:1963420-1963442 GGGGAGAGGAGGCAGGGAGGAGG + Intronic
1019627042 7:2021521-2021543 GGGGAGCCAAGGCAGGCAGATGG + Intronic
1019637234 7:2082377-2082399 GGGGAGCTCAGCAAGGGAGATGG + Intronic
1019705236 7:2494379-2494401 GGTGGGGGCAGGAAGGGAGCGGG + Intergenic
1019715963 7:2539522-2539544 GGTGAGTGCTGGCAGGTGGAGGG - Exonic
1019728741 7:2617864-2617886 GGTGAGAACGGGCAGGGAGACGG - Intergenic
1019844964 7:3489177-3489199 GGTGGGTGCAGGCAGGTACAGGG + Intronic
1020256129 7:6503953-6503975 GGTGAGCAGGGGCCGGGAGAGGG + Intronic
1020711386 7:11609667-11609689 TGTGACCACAGGCAGGGAGGTGG + Intronic
1021096994 7:16546789-16546811 GTTGATCACAGGAAGGGAGAGGG - Intronic
1021140785 7:17022202-17022224 TGTCAGGGCAGGCAGGTAGATGG - Intergenic
1021408627 7:20303240-20303262 GGTGATGGCAGGCTGTGAGAAGG + Intergenic
1021928295 7:25554218-25554240 GGTCAGTGCAGGGAGGCAGAGGG - Intergenic
1022247280 7:28572604-28572626 GGTGGGGGGTGGCAGGGAGAGGG - Intronic
1022472856 7:30692406-30692428 GGCGAGCTCAGTGAGGGAGATGG - Intronic
1022510607 7:30932867-30932889 GGTGAGCCCAGGCAGAGCTACGG + Intergenic
1023400256 7:39787591-39787613 GGGGAGCTGAGGCAGGAAGATGG + Intergenic
1023473456 7:40551005-40551027 CCTGAGGGAAGGCAGGGAGAAGG - Intronic
1023818978 7:43969868-43969890 GGTCAGCTCAGCCAGGGACACGG + Intergenic
1023830768 7:44037912-44037934 GGTGAGAGCAGGCTAGGAGTAGG - Intergenic
1023845408 7:44117426-44117448 GGTGAGACCTGGCTGGGAGATGG - Intronic
1024073187 7:45803342-45803364 GGGGAGCTGAGGCAGGAAGATGG + Intergenic
1024251604 7:47509706-47509728 GGTTAGGGCAGGCAGGGGTAGGG - Intronic
1024650146 7:51396846-51396868 GGGGAGCTGAGGCAGGAAGATGG - Intergenic
1025054294 7:55752495-55752517 GGGGAGCTGAGGCAGGAAGATGG - Intergenic
1025132343 7:56382647-56382669 GGGGAGCTGAGGCAGGAAGATGG - Intergenic
1025978009 7:66384910-66384932 GGGGAGCTGAGGCAGGAAGATGG - Intronic
1026806160 7:73430514-73430536 GGGGAGGGGAGGCAGGGGGAGGG - Intergenic
1027203591 7:76079577-76079599 GGGGAGCTGAGGCAGGAAGATGG - Intergenic
1027266452 7:76497608-76497630 GCCGAGCGGGGGCAGGGAGAAGG - Intronic
1027317833 7:76995726-76995748 GCCGAGCGGGGGCAGGGAGAAGG - Intergenic
1028168388 7:87566011-87566033 GGTGAGAGCAGGAAGGGAGAAGG + Intronic
1028841549 7:95434790-95434812 GGAGGGCGCAGGCTGGGGGAGGG - Intronic
1029117202 7:98243433-98243455 GGGGAGCCAGGGCAGGGAGAGGG + Intronic
1029268025 7:99357910-99357932 GGTGAGCACAGGCAAGGAGAAGG + Intronic
1030716727 7:112816274-112816296 GGTGAGGGCAGGTGGGGGGAGGG - Intergenic
1031941281 7:127792254-127792276 TGTGGGGGCAGGCAGGGTGAAGG + Intronic
1032013680 7:128362221-128362243 GGAGAGGGCCGGCAGGGAGACGG - Intergenic
1032850654 7:135792236-135792258 GTTGAGTGCAGGGAGGGAAAAGG - Intergenic
1033096404 7:138435489-138435511 GGTGAGCGCACGCCTGGACAAGG + Intergenic
1034396059 7:150825753-150825775 GGTGAGAAGAGGCAAGGAGAGGG - Intronic
1034458781 7:151186726-151186748 GGTGGGCAGAGGCAGGAAGAGGG + Intronic
1034677373 7:152901635-152901657 GGTGTCTGCAGGGAGGGAGACGG - Intergenic
1034880294 7:154757718-154757740 GGTGAGCGCAGGCACTAGGATGG + Intronic
1035058214 7:156050914-156050936 GGTGAGCCCAGGGTGGGTGAGGG - Intergenic
1035265836 7:157690014-157690036 GGGGGGTGCAGGCACGGAGATGG - Intronic
1035464410 7:159065271-159065293 GGGGAGGGGAGGGAGGGAGATGG - Intronic
1035746574 8:1965721-1965743 GGTGAGCGGTGGCAGGCAGGTGG - Intergenic
1036190102 8:6662384-6662406 GGTGAGTGGAGGCAGGGAGAGGG - Intergenic
1036591702 8:10174336-10174358 GGTGAGCGAAGGCATGGCTAGGG + Intronic
1036678131 8:10851749-10851771 GGAGAAGGCAGGCAGGGGGAAGG + Intergenic
1036678141 8:10851775-10851797 GGAGAAGGCAGGCAGGGGGAAGG + Intergenic
1036713639 8:11099992-11100014 GTTGGGCGCTGGGAGGGAGAGGG + Intronic
1037297189 8:17413482-17413504 GGTGGGCGCAGGCGCGGAGGTGG - Intronic
1037717028 8:21409397-21409419 GGTAAGGGGAGGCAGGAAGAAGG - Intergenic
1037778200 8:21849433-21849455 GGTTGCAGCAGGCAGGGAGAAGG - Intergenic
1037835526 8:22212918-22212940 GGTGTGCGATGGCAGGAAGAAGG - Intergenic
1038433253 8:27516438-27516460 GGAGCGCTCAGGCAGGTAGAAGG - Intronic
1038622154 8:29154402-29154424 GGGGAGGGGAGGCAGGGAGCCGG + Intronic
1039490260 8:37942178-37942200 GGTGGGCGCATGTAGGGAGGAGG + Intergenic
1040311898 8:46241078-46241100 GGGGAGCTGAGGCAGGCAGAGGG + Intergenic
1040646312 8:49401444-49401466 GGTAACCGCAGGCAGGCAGCAGG + Intergenic
1040812831 8:51475770-51475792 GGTGAGGGAAGGGAGGGAGGGGG - Intronic
1040913586 8:52545501-52545523 GGTGTGTGCAGGGAGGGAGGTGG - Intronic
1041696708 8:60743338-60743360 GGTCACCGCTAGCAGGGAGATGG + Intronic
1042342457 8:67694622-67694644 GGTGCGGGCTGGCAGAGAGAAGG - Intronic
1045556358 8:103218404-103218426 GTTGAGCTCAGGTAGGGAGTAGG - Intronic
1048353585 8:133635292-133635314 GGTGGGTGGAGGGAGGGAGAGGG + Intergenic
1048451144 8:134534910-134534932 GGTGACAGCATGAAGGGAGAAGG - Intronic
1049044691 8:140140108-140140130 GGTGAGCACACGCAGGGGCAGGG + Intronic
1049316782 8:141973512-141973534 CGTGAGCGCAGGCACCGTGAGGG - Intergenic
1049357053 8:142194116-142194138 GGTGAGCGGATGCAGAGGGAGGG - Intergenic
1049414589 8:142489385-142489407 GGTGTGCGCAGGGAGCGAGGCGG - Exonic
1049578410 8:143400099-143400121 GTTGGGCCCAGGCAGGGGGAGGG + Intergenic
1049690722 8:143957755-143957777 GCTGAGGGCAGGCAGGGTGGTGG - Intronic
1049691261 8:143960751-143960773 GGTGGGGGGAGACAGGGAGAAGG - Intronic
1050535443 9:6626786-6626808 GGTGACTGAAGGGAGGGAGATGG - Intronic
1051060250 9:13037401-13037423 GGCGTGAGCAGGCAAGGAGATGG - Intergenic
1051215784 9:14795884-14795906 GGTGAAAGCTGGCAGGGTGAGGG - Intronic
1055462082 9:76528821-76528843 GGTGGGCGCGGGCTGGGAGCGGG - Intergenic
1056172166 9:83996849-83996871 GGGGAGGGCAGAGAGGGAGAAGG + Intronic
1056243171 9:84669239-84669261 GGAGAACGCGGGGAGGGAGAAGG + Intronic
1056346577 9:85702143-85702165 GTTGAGTGCATGGAGGGAGAAGG - Intronic
1056481520 9:87011633-87011655 GGGGAGCGCCCGCAGGGGGAGGG - Intergenic
1056515194 9:87343340-87343362 GGAGAGAGGAGGCAAGGAGAAGG - Intergenic
1056771672 9:89482022-89482044 GGGGAAAGGAGGCAGGGAGAGGG + Intronic
1056814546 9:89791938-89791960 GCTGAGAGCAGGCTGGGAGCAGG + Intergenic
1057215944 9:93228865-93228887 GGTGAGCTCAGACAGGGTGGTGG + Intronic
1058842194 9:108920618-108920640 GGAGAGCCCAGGCAGGGAACAGG + Intronic
1060526367 9:124323485-124323507 GGTGAGGGCAGGGACGGAGGAGG + Intronic
1060973924 9:127754182-127754204 GGCGCGCGCAGGCCGGGAGGCGG - Intronic
1060995220 9:127871988-127872010 CGTGAGCAGAGGCTGGGAGAAGG - Intronic
1061087886 9:128409746-128409768 GGGGAAAGCAGGCTGGGAGAGGG - Intergenic
1061499325 9:130993203-130993225 TTTGAGGGCAGGCAGGGAGTGGG - Intergenic
1061998940 9:134206428-134206450 GCTGTGCACAGGCAGGAAGATGG - Intergenic
1062076022 9:134590407-134590429 GGTGAGCACAGCCAGGCACATGG + Intergenic
1062125112 9:134856015-134856037 GATGAGAGTAGGCAGGGAGCGGG + Intergenic
1062194195 9:135264026-135264048 GGAGAGGGCAGGAGGGGAGAGGG - Intergenic
1062266839 9:135690448-135690470 GCTGAGGGCAGGCAGGGGGAGGG + Intergenic
1062485080 9:136770417-136770439 GGTGCGGGCAGGCGGGGTGAGGG - Intergenic
1062485120 9:136770511-136770533 GGTGCGGGCAGGCGGGGTGAGGG - Intergenic
1062535012 9:137017597-137017619 GGTGAGTGCTGTCACGGAGATGG + Exonic
1062610452 9:137371208-137371230 GGAGAGTGCAGGGAGGCAGAAGG - Intronic
1062612539 9:137381571-137381593 GGTGAGAGCAGCCTGGGAGACGG - Intronic
1185633131 X:1531379-1531401 GGAGAGGGCATGCAGGAAGATGG - Intronic
1185772314 X:2773856-2773878 AGGGAGGGCAGGAAGGGAGAGGG + Intronic
1185995301 X:4940762-4940784 AGTGAGCCCAGGCAGGGTGGAGG + Intergenic
1186420293 X:9420193-9420215 ACTGGGCTCAGGCAGGGAGAGGG + Intergenic
1190054987 X:47176121-47176143 GGTGAGGGGAGACAGGGAGGGGG - Intronic
1190277745 X:48910117-48910139 GGTGAGGGCAGGCAGGCTGAGGG - Intronic
1192184866 X:68940191-68940213 GGTGAGGACAACCAGGGAGAAGG - Intergenic
1192450896 X:71244259-71244281 GGTGTGGGGAGGCAGGGACAGGG - Intronic
1195299089 X:103509505-103509527 GGAGAGGGGAGGGAGGGAGAGGG - Intronic
1196016288 X:110944154-110944176 GGGGAGCGAGGGCGGGGAGAAGG - Intergenic
1196686407 X:118514138-118514160 AGTGAGTGCAGGCAGGGGAAAGG - Intronic
1196705456 X:118713517-118713539 GGGGAGGGCAGGCAGGGAAGAGG - Intergenic
1198077988 X:133212799-133212821 GGAGAGGGAAGACAGGGAGAGGG + Intergenic
1198275431 X:135094532-135094554 GGTGACCTCAGGCAGGGAGAAGG + Intergenic
1198531371 X:137551703-137551725 GGGGAGAGTAGGGAGGGAGATGG + Intergenic
1199130717 X:144182849-144182871 GGGGTGGGCGGGCAGGGAGATGG - Intergenic
1200766315 Y:7083598-7083620 GGAGAGCCCAGGGAGGCAGAAGG - Intronic
1201298413 Y:12485596-12485618 AGGGAGGGCAGGGAGGGAGAGGG - Intergenic
1202327451 Y:23706195-23706217 GTTAAGGGCAGGCAGAGAGAAGG + Intergenic
1202543319 Y:25963857-25963879 GTTAAGGGCAGGCAGAGAGAAGG - Intergenic