ID: 909605071

View in Genome Browser
Species Human (GRCh38)
Location 1:77499738-77499760
Sequence GGGTCTCTCTAGGAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909605071_909605080 13 Left 909605071 1:77499738-77499760 CCATCAGACTCCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 909605080 1:77499774-77499796 TCAGAGGACGATTTGCTAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 62
909605071_909605076 -3 Left 909605071 1:77499738-77499760 CCATCAGACTCCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 909605076 1:77499758-77499780 CCCCTTGGGAACCTCTTCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909605071 Original CRISPR GGGTCTCTCTAGGAGTCTGA TGG (reversed) Intronic
903691236 1:25175108-25175130 GGTTCTCTCTAGGCTTATGAGGG + Intergenic
904555924 1:31364246-31364268 GAGTCTTTCCAGGAGTCTCAAGG - Exonic
908147807 1:61266198-61266220 GGGTCTCTATGGGAGTCAGGAGG - Intronic
909605071 1:77499738-77499760 GGGTCTCTCTAGGAGTCTGATGG - Intronic
913123906 1:115767848-115767870 GCGTCTCTCTGGGGGTCAGACGG - Intronic
914247356 1:145896173-145896195 GGGTCTCTCTTGGATTTTAATGG - Intronic
917542214 1:175925516-175925538 GTGTTTCTCAAGGAGTCTCAGGG - Intergenic
918184553 1:182115407-182115429 GGGTCTCTCTAGGACTGGGGAGG - Intergenic
918467646 1:184837612-184837634 GTGTCTGTCTGGGATTCTGAAGG - Intronic
918595362 1:186286730-186286752 GGCTCGCCCTAGGAGTCTGGCGG - Intergenic
920301972 1:204994483-204994505 GTGTGTCTCTGCGAGTCTGAGGG + Intronic
920371322 1:205481125-205481147 GGGGCTTTCCAGGAGTCTGGTGG - Intergenic
1064628614 10:17286383-17286405 GGGCCTCTCTATGAGGCAGATGG - Intergenic
1065295157 10:24267279-24267301 TGGTCTCTCAAGGAGTCTGTTGG + Intronic
1066041247 10:31549918-31549940 GGGTTTCTATAGGAGACAGAAGG + Intergenic
1069683744 10:70303280-70303302 GGGACTCTTTAGGGGTATGATGG - Intronic
1070311828 10:75279357-75279379 GGGTCTCTCTTGGACTGGGAAGG + Intergenic
1070573820 10:77661874-77661896 GGGTGTCTCTTGGAAACTGAAGG - Intergenic
1070658761 10:78289815-78289837 GCGTCTCTCTCCGAGTCTCAAGG - Intergenic
1071396441 10:85228408-85228430 GGGCCTCTATAGGAGCCTGTTGG - Intergenic
1074143248 10:110695464-110695486 GGGTCTCCAGAAGAGTCTGAGGG - Intronic
1074431137 10:113395798-113395820 GTGTCTCTCTAGGACTATGAGGG - Intergenic
1074763299 10:116683529-116683551 GCTTCTCTCTAAGAATCTGAGGG - Intronic
1075262521 10:120975589-120975611 GGGCCTCTCTAGGCATGTGAAGG - Intergenic
1076674660 10:132141781-132141803 GGGTCTCTCTAGCAGCATGAGGG - Intronic
1081084643 11:38784958-38784980 GGGTCTCCCTAGAAGTATGGAGG - Intergenic
1084065938 11:66704569-66704591 TGGTCCCACTAGGAGCCTGAGGG + Intronic
1084962651 11:72725438-72725460 GGGTCTCTCCAGGAACCTGGAGG - Intronic
1085125332 11:73998067-73998089 TGGTGTCTCTAGGAGTGTGGTGG + Intergenic
1086661327 11:89422671-89422693 GGGTTTCTCTAAGAGTCTATGGG - Intronic
1096675621 12:53224242-53224264 GGGGCTGTCTCGGGGTCTGAAGG - Intronic
1097441115 12:59609817-59609839 GGTACTCTCTTGGTGTCTGAAGG + Intronic
1100692378 12:97052117-97052139 GGGTCTTTCTTGCAGTATGAAGG + Intergenic
1100743643 12:97622363-97622385 GGGTCTCTTTAGCAGTCTCAGGG + Intergenic
1101447548 12:104748167-104748189 GGGTGGATCTAGGAGTCTGTCGG + Intronic
1101999274 12:109546493-109546515 GGGTCTCTTTAGGATGCTGTGGG + Intergenic
1102340340 12:112116599-112116621 GGGTCTCTGCAGGTGTCTGTGGG + Intergenic
1103375249 12:120450662-120450684 CGGTCTCTTTAAGAGCCTGAGGG + Intronic
1103628060 12:122235614-122235636 GTGTCCTTCTAGGATTCTGATGG + Intronic
1107396272 13:40021176-40021198 GTGTCTCTATAGGAGGCTCAGGG + Intergenic
1113641241 13:111958754-111958776 GGGTCACGCTAAGAGTTTGAGGG + Intergenic
1119413775 14:74456049-74456071 TGATTTCTGTAGGAGTCTGATGG + Intergenic
1123114954 14:105890432-105890454 GGGTCCCGGGAGGAGTCTGAAGG + Intergenic
1130150900 15:81310820-81310842 TGGTCTCTCAAGGAGTCTCTTGG - Exonic
1130874985 15:88005970-88005992 GGGGCTCACTAGGAGGCAGATGG + Intronic
1131260553 15:90885261-90885283 GGGTCTCTATGGGACTCTGGTGG + Intronic
1131387091 15:92016945-92016967 GGATCTCTCTAGAAGTCACAAGG + Intronic
1138851269 16:60632639-60632661 GTGTTTCTCAAGGGGTCTGAGGG + Intergenic
1146927142 17:36753009-36753031 GGGTCTTGCCAGGAGTCTGAGGG - Intergenic
1148226120 17:45898948-45898970 GGGTGTTTCTGGGAGTGTGAGGG - Intronic
1150197544 17:63316425-63316447 GGATCTCTCTATGAGCCTGGGGG + Intronic
1156345165 18:36250429-36250451 GGATCACTCTGGGAGTGTGAAGG + Intronic
1156516548 18:37685228-37685250 GGGTGTCATTTGGAGTCTGAAGG - Intergenic
1158832970 18:61300795-61300817 GGATCTATCTAGGTGTTTGAAGG + Intergenic
1164539778 19:29114049-29114071 GGCTCACTCTAGGAGGCTGTGGG + Intergenic
1165845914 19:38817430-38817452 GGGTGACTCTAGGGGTCTGGAGG - Exonic
1166965811 19:46528855-46528877 GGGTCTCCCTAGGGGGTTGATGG - Intronic
1167080866 19:47275294-47275316 GCGTCTCTCTGGGTGTCTGGCGG - Exonic
1167412796 19:49355087-49355109 AGGTCTCTGTGGGAGTGTGAGGG + Intronic
1168328743 19:55553720-55553742 GGATCTCTCTAGAAGTCTGCAGG + Intergenic
925723663 2:6852498-6852520 GGGGCTTCCTAGGAGTCTGAAGG - Intronic
926289226 2:11515574-11515596 GGCTCTCCCTGGGAGCCTGAGGG + Intergenic
927890526 2:26745300-26745322 GAGTTTCTCCAGGAGTCAGATGG - Intergenic
929791491 2:45026318-45026340 GGATCTCTCTAGGACTTTGTTGG - Intergenic
930288734 2:49467228-49467250 TGGTATCTCTATGAGTCTGCAGG - Intergenic
931288864 2:60855141-60855163 GGGTGATTCTAGGAGTCTGGAGG - Intergenic
933185743 2:79277517-79277539 GGCTTTCTCAAGGAGACTGACGG + Intronic
937953022 2:127402658-127402680 CTGTCTCTCTAGGTGACTGATGG + Intergenic
939640318 2:144633157-144633179 GGGTCTTTCTTGGATGCTGATGG - Intergenic
941588754 2:167392014-167392036 TGGTCTCTGTAGAACTCTGAAGG + Intergenic
947800554 2:232926980-232927002 GGGTCCCTGGAGGACTCTGAGGG - Intronic
948073281 2:235144723-235144745 GTGCCTCTCCAGGAGTCTAATGG + Intergenic
948138119 2:235652405-235652427 GGGTGGCTCTTGGAGGCTGATGG - Intronic
1172963122 20:38812762-38812784 GGGTCTCTGTAGGAGTTTGAAGG + Intronic
1172974314 20:38894833-38894855 CGTTCTCTCTAGGAGGCTGCAGG + Intronic
1173229823 20:41185412-41185434 GGGTCTCTCAGAGAGTCTGATGG - Intronic
1173874323 20:46360396-46360418 TGGACCCTCTAGGAGTGTGATGG - Intronic
1175248438 20:57595149-57595171 GGGCCCCTCTTGGAGCCTGAGGG + Intergenic
1178234404 21:30824602-30824624 GGTTCTCTATGGGAGTTTGAAGG - Intergenic
1179983236 21:44907248-44907270 GGGGCTGTCTGGGAGGCTGAAGG - Intronic
1180076256 21:45464636-45464658 GGGTCCCTCTGGGACTCTGGAGG + Intronic
1181695222 22:24589589-24589611 GGGTCTGCCCAGGACTCTGAGGG + Intronic
951476989 3:23117624-23117646 GGGACACTCCAGGAATCTGAAGG - Intergenic
953182370 3:40608038-40608060 AGGTCTCTCTGGGAGCCTAAAGG + Intergenic
956304061 3:67804957-67804979 TGGTCTATCTGGGACTCTGAGGG - Intergenic
961107188 3:124252030-124252052 GGGTTTCCCTGGGACTCTGATGG + Intronic
967988709 3:195115350-195115372 TGGACTCTCTAGGAGGCTGAAGG - Intronic
969194437 4:5549378-5549400 GGGTCTCACAGGTAGTCTGAGGG + Intronic
969855009 4:9991960-9991982 GTGTCTCTCTAGGTGCCTGCTGG - Intronic
970873737 4:20845655-20845677 GGGTCTCTCTAGTCCTCTAATGG - Intronic
975724534 4:77279093-77279115 AGGTCTCTCTACTAGGCTGAGGG + Intronic
983642810 4:169958908-169958930 TGTTCTCTCTAGTTGTCTGAGGG - Intergenic
986300464 5:6474670-6474692 GGTTATCACTATGAGTCTGAAGG - Intronic
986486272 5:8241649-8241671 GCGAGTCTCCAGGAGTCTGAAGG - Intergenic
991601244 5:68353380-68353402 GGGTAATTATAGGAGTCTGAAGG + Intergenic
995405402 5:111789014-111789036 GTGTCCCACTTGGAGTCTGAAGG - Intronic
997976405 5:138444125-138444147 GGTTTTCTCTAGGAGTGAGAGGG + Intronic
998107408 5:139477245-139477267 GGGTCTCCCAAAGAGTCAGAAGG - Intronic
1001552817 5:172616966-172616988 GGGTCTCTCAGGGAGACTCACGG - Intergenic
1005069260 6:21849430-21849452 GGGTTTTTCTAGGAGTACGAAGG + Intergenic
1005587737 6:27293390-27293412 AGGTCACTTTAGGAATCTGAAGG + Intronic
1007284096 6:40735495-40735517 GGGCCCCTCTAGGACTCTGGGGG - Intergenic
1009778905 6:68243384-68243406 TGTTCTCTCTAGGAGACAGAAGG + Intergenic
1012719192 6:102719882-102719904 GGCATTCACTAGGAGTCTGAAGG - Intergenic
1016312759 6:142751928-142751950 GGGTCGCACTTGGACTCTGAGGG - Exonic
1018902860 6:168060025-168060047 GGGGCTTCCTAGGAGTCAGAAGG + Intronic
1020766078 7:12322977-12322999 GGGTCTTTTTTGGAGGCTGATGG + Intergenic
1021709326 7:23399499-23399521 GGCTCCCTCTAGAAGTCTTAGGG - Intronic
1022681530 7:32551866-32551888 GGATCTCTCTTGGATTCTGGTGG + Intronic
1023089812 7:36607410-36607432 GAGTCTCCCTTGGGGTCTGATGG - Intronic
1023632082 7:42175074-42175096 GGGTCTCTCTGGGAATTTAATGG - Intronic
1023683548 7:42713171-42713193 TTGTCTCTCTAGGAGCCAGATGG + Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1029227088 7:99036067-99036089 GGGTCTCTCCAGGACACTCAAGG + Intronic
1029290725 7:99500338-99500360 GGGCCTCTCTAGGCGCCTGATGG + Intronic
1030013159 7:105191239-105191261 GGGTCTCCCTATGTGTCTCAGGG - Intronic
1032223562 7:130012121-130012143 GGGTCTGCCTTGGAGGCTGATGG + Intergenic
1035053750 7:156019936-156019958 GGGTCTCACTAGGACCTTGAGGG + Intergenic
1038513174 8:28159964-28159986 GGATCTCTGTAAGAGTCTCAAGG + Intronic
1048271643 8:133033049-133033071 GGGACTCTCTTGGGGTCTCAAGG + Intronic
1048398736 8:134042431-134042453 CCATCTCTCTAGGAGTCTGCTGG - Intergenic
1048497332 8:134946231-134946253 CGGTCTCTTTAGGAGGATGAGGG + Intergenic
1049478291 8:142806989-142807011 GGGTCTCTCTGGGGTTCTGGAGG + Intergenic
1049482874 8:142835129-142835151 GGGTCTCCCTGGGACCCTGAGGG - Intronic
1049482897 8:142835202-142835224 GGGTCTCCCTGGGACCCTGATGG - Intronic
1050056204 9:1658058-1658080 GGCTCTCTCTAGAATTCTTAAGG + Intergenic
1052011969 9:23421261-23421283 GGGTCTCAGCAGGAATCTGATGG + Intergenic
1055955782 9:81772536-81772558 GGGTCTCTTTAGGAAACTGATGG + Intergenic
1058634138 9:107019968-107019990 GAGTCACTCTAGGAATCTGAGGG + Intergenic
1060151568 9:121292254-121292276 GGGTGTCATTAGGAGTCTCATGG + Intronic
1203760879 EBV:12652-12674 GGGTCTGTCTGGGGGGCTGAGGG - Intergenic
1203761808 EBV:15724-15746 GGGTCTGTCTGGGGGGCTGAGGG - Intergenic
1203762737 EBV:18796-18818 GGGTCTGTCTGGGGGGCTGAGGG - Intergenic
1203763666 EBV:21868-21890 GGGTCTGTCTGGGGGGCTGAGGG - Intergenic
1203764595 EBV:24940-24962 GGGTCTGTCTGGGGGGCTGAGGG - Intergenic
1203765524 EBV:28012-28034 GGGTCTGTCTGGGGGGCTGAGGG - Intergenic
1203766453 EBV:31084-31106 GGGTCTGTCTGGGGGGCTGAGGG - Intergenic
1203767382 EBV:34156-34178 GGGTCTGTCTGGGGGGCTGAGGG - Intergenic
1185510570 X:661150-661172 GGGTATCACTAGTAGTCAGATGG - Intergenic
1188526828 X:31096400-31096422 GGGTGTATCTAGGGGTATGATGG - Intergenic
1191916581 X:66207736-66207758 GGATCTCTTTAGGAGTCAGTGGG - Intronic
1193513625 X:82435902-82435924 TGGTGTCTCTTGGAGTCAGACGG - Intergenic
1194455585 X:94099083-94099105 AAATCTCTCTATGAGTCTGATGG + Intergenic
1194608955 X:96017216-96017238 GGGTCTCTCTAGGGGAAAGAGGG - Intergenic
1197598353 X:128495093-128495115 GGGTATATCTAGGTGTCTGTGGG + Intergenic
1198298370 X:135309271-135309293 GGGGCTGTGTAGGAGCCTGATGG - Intronic
1198307447 X:135397164-135397186 GGGGCTGTATAGGAGCCTGACGG - Intergenic
1200000903 X:153059286-153059308 TGATCTCTCCAGGAGTCTGGTGG - Intronic