ID: 909605936

View in Genome Browser
Species Human (GRCh38)
Location 1:77508384-77508406
Sequence CATGGTTACCAGAGTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909605936_909605943 25 Left 909605936 1:77508384-77508406 CCAGCTTCACTCTGGTAACCATG No data
Right 909605943 1:77508432-77508454 CATTACCAGTCTCATGGCAAAGG 0: 1
1: 0
2: 1
3: 13
4: 121
909605936_909605944 26 Left 909605936 1:77508384-77508406 CCAGCTTCACTCTGGTAACCATG No data
Right 909605944 1:77508433-77508455 ATTACCAGTCTCATGGCAAAGGG No data
909605936_909605942 19 Left 909605936 1:77508384-77508406 CCAGCTTCACTCTGGTAACCATG No data
Right 909605942 1:77508426-77508448 CCGAAACATTACCAGTCTCATGG 0: 1
1: 0
2: 0
3: 6
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909605936 Original CRISPR CATGGTTACCAGAGTGAAGC TGG (reversed) Intronic
No off target data available for this crispr