ID: 909607176

View in Genome Browser
Species Human (GRCh38)
Location 1:77519257-77519279
Sequence CCATGATAGGCTCTGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909607170_909607176 -6 Left 909607170 1:77519240-77519262 CCCTGCCACACTGGGTCCCATGA 0: 1
1: 1
2: 0
3: 20
4: 196
Right 909607176 1:77519257-77519279 CCATGATAGGCTCTGTAATGAGG No data
909607171_909607176 -7 Left 909607171 1:77519241-77519263 CCTGCCACACTGGGTCCCATGAT No data
Right 909607176 1:77519257-77519279 CCATGATAGGCTCTGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909607176 Original CRISPR CCATGATAGGCTCTGTAATG AGG Intronic
No off target data available for this crispr