ID: 909610003

View in Genome Browser
Species Human (GRCh38)
Location 1:77541582-77541604
Sequence CAGGTTAGGCCAGCGGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909610003_909610009 15 Left 909610003 1:77541582-77541604 CCAACTCCCGCTGGCCTAACCTG No data
Right 909610009 1:77541620-77541642 TTATAAGGTTAGAAGACTCAAGG 0: 1
1: 0
2: 2
3: 10
4: 148
909610003_909610008 0 Left 909610003 1:77541582-77541604 CCAACTCCCGCTGGCCTAACCTG No data
Right 909610008 1:77541605-77541627 AAACACAGAACTTCATTATAAGG No data
909610003_909610010 21 Left 909610003 1:77541582-77541604 CCAACTCCCGCTGGCCTAACCTG No data
Right 909610010 1:77541626-77541648 GGTTAGAAGACTCAAGGCTGAGG 0: 1
1: 0
2: 2
3: 18
4: 137
909610003_909610011 30 Left 909610003 1:77541582-77541604 CCAACTCCCGCTGGCCTAACCTG No data
Right 909610011 1:77541635-77541657 ACTCAAGGCTGAGGCACAGCAGG 0: 1
1: 0
2: 1
3: 20
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909610003 Original CRISPR CAGGTTAGGCCAGCGGGAGT TGG (reversed) Intronic
No off target data available for this crispr