ID: 909612981

View in Genome Browser
Species Human (GRCh38)
Location 1:77572703-77572725
Sequence AATTGGGCCTGCAGTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909612981_909612990 23 Left 909612981 1:77572703-77572725 CCAGGTTCACTGCAGGCCCAATT No data
Right 909612990 1:77572749-77572771 ATCTCAGCCTCTTGAGTAGATGG No data
909612981_909612991 24 Left 909612981 1:77572703-77572725 CCAGGTTCACTGCAGGCCCAATT No data
Right 909612991 1:77572750-77572772 TCTCAGCCTCTTGAGTAGATGGG 0: 2
1: 455
2: 14212
3: 131727
4: 229718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909612981 Original CRISPR AATTGGGCCTGCAGTGAACC TGG (reversed) Intronic
No off target data available for this crispr