ID: 909612990

View in Genome Browser
Species Human (GRCh38)
Location 1:77572749-77572771
Sequence ATCTCAGCCTCTTGAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909612984_909612990 6 Left 909612984 1:77572720-77572742 CCAATTTCCCAGGCTCAAGTGAT 0: 2
1: 24
2: 152
3: 663
4: 2350
Right 909612990 1:77572749-77572771 ATCTCAGCCTCTTGAGTAGATGG No data
909612986_909612990 -2 Left 909612986 1:77572728-77572750 CCAGGCTCAAGTGATCCTCCCAT 0: 332
1: 3913
2: 9912
3: 17222
4: 27929
Right 909612990 1:77572749-77572771 ATCTCAGCCTCTTGAGTAGATGG No data
909612983_909612990 7 Left 909612983 1:77572719-77572741 CCCAATTTCCCAGGCTCAAGTGA No data
Right 909612990 1:77572749-77572771 ATCTCAGCCTCTTGAGTAGATGG No data
909612985_909612990 -1 Left 909612985 1:77572727-77572749 CCCAGGCTCAAGTGATCCTCCCA 0: 3104
1: 16014
2: 38416
3: 71963
4: 135317
Right 909612990 1:77572749-77572771 ATCTCAGCCTCTTGAGTAGATGG No data
909612981_909612990 23 Left 909612981 1:77572703-77572725 CCAGGTTCACTGCAGGCCCAATT No data
Right 909612990 1:77572749-77572771 ATCTCAGCCTCTTGAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909612990 Original CRISPR ATCTCAGCCTCTTGAGTAGA TGG Intronic
No off target data available for this crispr