ID: 909612991

View in Genome Browser
Species Human (GRCh38)
Location 1:77572750-77572772
Sequence TCTCAGCCTCTTGAGTAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376114
Summary {0: 2, 1: 455, 2: 14212, 3: 131727, 4: 229718}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909612983_909612991 8 Left 909612983 1:77572719-77572741 CCCAATTTCCCAGGCTCAAGTGA No data
Right 909612991 1:77572750-77572772 TCTCAGCCTCTTGAGTAGATGGG 0: 2
1: 455
2: 14212
3: 131727
4: 229718
909612981_909612991 24 Left 909612981 1:77572703-77572725 CCAGGTTCACTGCAGGCCCAATT No data
Right 909612991 1:77572750-77572772 TCTCAGCCTCTTGAGTAGATGGG 0: 2
1: 455
2: 14212
3: 131727
4: 229718
909612986_909612991 -1 Left 909612986 1:77572728-77572750 CCAGGCTCAAGTGATCCTCCCAT 0: 332
1: 3913
2: 9912
3: 17222
4: 27929
Right 909612991 1:77572750-77572772 TCTCAGCCTCTTGAGTAGATGGG 0: 2
1: 455
2: 14212
3: 131727
4: 229718
909612985_909612991 0 Left 909612985 1:77572727-77572749 CCCAGGCTCAAGTGATCCTCCCA 0: 3104
1: 16014
2: 38416
3: 71963
4: 135317
Right 909612991 1:77572750-77572772 TCTCAGCCTCTTGAGTAGATGGG 0: 2
1: 455
2: 14212
3: 131727
4: 229718
909612984_909612991 7 Left 909612984 1:77572720-77572742 CCAATTTCCCAGGCTCAAGTGAT 0: 2
1: 24
2: 152
3: 663
4: 2350
Right 909612991 1:77572750-77572772 TCTCAGCCTCTTGAGTAGATGGG 0: 2
1: 455
2: 14212
3: 131727
4: 229718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909612991 Original CRISPR TCTCAGCCTCTTGAGTAGAT GGG Intronic
Too many off-targets to display for this crispr