ID: 909614947

View in Genome Browser
Species Human (GRCh38)
Location 1:77597204-77597226
Sequence GGTTCCCAACAACCAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909614942_909614947 20 Left 909614942 1:77597161-77597183 CCTTGATGGGGTTATATCACAGG No data
Right 909614947 1:77597204-77597226 GGTTCCCAACAACCAAAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909614947 Original CRISPR GGTTCCCAACAACCAAAAGC TGG Intronic
900725976 1:4216553-4216575 GGTTCCCTAGAACCACATGCTGG - Intergenic
901107045 1:6764544-6764566 TATTCCCAATAACCAAAAGGTGG - Intergenic
901662919 1:10809938-10809960 GGTTACCAACAACCAAAGTAAGG + Intergenic
903624290 1:24720131-24720153 GGTTCCCCACATCCCACAGCCGG - Intergenic
905740077 1:40362281-40362303 GGTTGAACACAACCAAAAGCTGG + Intronic
906304894 1:44711119-44711141 GGTTCACAAGAGCCAAAGGCTGG - Intronic
907730742 1:57062922-57062944 GGTTCCCACCAGCCAAAAGAAGG - Exonic
908709459 1:66998591-66998613 AGTACCCATCAACCAAAGGCTGG + Intergenic
909614947 1:77597204-77597226 GGTTCCCAACAACCAAAAGCTGG + Intronic
911739736 1:101374327-101374349 GGTTCCCATCAACCAAGTGGTGG - Intergenic
912488058 1:110044943-110044965 GGATCCCAAACACCAAAGGCCGG - Intronic
917390068 1:174526467-174526489 GTCTCCCAACAAAGAAAAGCCGG - Intronic
918429373 1:184443297-184443319 AGTTCCAAACAGCAAAAAGCAGG - Intronic
918878830 1:190086531-190086553 GGTTCACAACAGATAAAAGCAGG + Intergenic
920283768 1:204864287-204864309 TGTTCACAACAGCCAAAAGATGG - Intronic
920669183 1:207990129-207990151 TATTCCCAACAGCCAAAAGCTGG - Intergenic
922773409 1:228202296-228202318 TATTCCCAACAGCCAAGAGCTGG - Intergenic
922801786 1:228367860-228367882 GGATCCCATCAAGGAAAAGCAGG - Intronic
924448590 1:244157380-244157402 TATTCACAACAACCAAAAGGTGG - Intergenic
1063389842 10:5642114-5642136 GTTTTTCAACATCCAAAAGCAGG + Intronic
1066678709 10:37915330-37915352 TGCTCCCAAAAAACAAAAGCTGG - Intergenic
1068493392 10:57753425-57753447 TGTTCACAATAACCAAAAGTTGG + Intergenic
1073628599 10:105124702-105124724 TGTTCCCATCAAACACAAGCTGG - Intronic
1074383985 10:113002636-113002658 TGTTCCCATCAACCAACACCAGG - Intronic
1076679920 10:132166540-132166562 AGTGCCCAGCAAACAAAAGCAGG - Intronic
1078026523 11:7700831-7700853 AGTTCCCAACATCCACAAACTGG + Intronic
1078074994 11:8150592-8150614 GGTTCCCAATACCAAAAGGCTGG + Intronic
1084686156 11:70696831-70696853 CATTCACAACAACCAAAAGGTGG + Intronic
1086253202 11:84842491-84842513 AGTTCCTAACTACCACAAGCAGG + Intronic
1090944758 11:131419972-131419994 GACTCCCAACAACCAAAGGAAGG - Intronic
1095034116 12:37336340-37336362 AGTTCCAAACATCCACAAGCAGG + Intergenic
1095034229 12:37338552-37338574 AGTTCCAAACATCCACAAGCAGG + Intergenic
1096165738 12:49422236-49422258 GTTTCCCAAGAACAAAGAGCTGG - Intronic
1098877417 12:75880846-75880868 GGTTCCACACAACCATAAGGGGG - Intergenic
1098978036 12:76924037-76924059 GGATCACAAGAACCAAAAGCAGG - Intergenic
1101469016 12:104977704-104977726 GGTGACCAAGAACCAGAAGCTGG - Intergenic
1103798283 12:123520155-123520177 GATTCACAACAGCCAAAAGGTGG + Intronic
1108191665 13:47947135-47947157 GGTTCCCAAAGACCAAAGGTTGG + Intronic
1108936330 13:55885700-55885722 GGTTCTCAACATCCAACTGCAGG - Intergenic
1109933012 13:69242289-69242311 GGGTCCCAAAGTCCAAAAGCTGG + Intergenic
1110457105 13:75701524-75701546 GGTTCTCAACAGCAAAAAGATGG - Intronic
1110849652 13:80230886-80230908 GGTTCCCAACTTCCTAAATCTGG + Intergenic
1113452839 13:110423971-110423993 GATTCACAACAGCCAAAAGGTGG - Intronic
1117797315 14:59407802-59407824 GGTTCTCAACAACCAAGCCCAGG - Intergenic
1121588913 14:95084451-95084473 TGTTCACAACAGCCAAAAGGTGG + Intergenic
1122281271 14:100623821-100623843 GGCACCCAACATCCAGAAGCTGG - Intergenic
1122414799 14:101543901-101543923 CGTTCACAACAGCCAAAAGGTGG + Intergenic
1122546444 14:102525267-102525289 CGTTCCCAACAGCCAAAAGGTGG + Intergenic
1123980581 15:25598370-25598392 TGTTCACAAAAACCAAAAGTGGG + Intergenic
1128081377 15:64859195-64859217 TGTTCACAACAGCCAAAAGGTGG - Intronic
1129105914 15:73307111-73307133 GGTTCCCAGCTACCAAAGGAGGG + Intergenic
1129512546 15:76135567-76135589 GGTTCCCAAAAAGCAGATGCTGG - Intronic
1137727606 16:50667640-50667662 GGTTCCCAACACCAACACGCTGG + Intronic
1137923832 16:52520392-52520414 TGTTTACAACAAGCAAAAGCTGG + Intronic
1138098734 16:54234531-54234553 TTTTCCCAACAGCCAAAAGGTGG - Intergenic
1139316653 16:66077130-66077152 TATTCACAACAACCAAAAACTGG + Intergenic
1139354501 16:66359598-66359620 GGTTCCGACCAGCCAAAAGAAGG - Intergenic
1141887127 16:86899878-86899900 GATTCACAACAACCAAAATATGG + Intergenic
1145824089 17:27863456-27863478 GGCTCTCAAAAACCAGAAGCAGG + Intronic
1149092466 17:52800661-52800683 AGTTCCCAACAGCCAAAATTTGG - Intergenic
1152779927 17:82222404-82222426 TGTTCACAACAGCCAAAAGGTGG + Intergenic
1153109808 18:1572233-1572255 GGTTCCCATCATCCAAATGAAGG + Intergenic
1155314320 18:24556452-24556474 TGTTCACAACAGCCAAAAGGTGG + Intergenic
1159793367 18:72811861-72811883 GGTCTCCAAGAACCAAAAGAAGG - Intronic
1160191673 18:76719660-76719682 TATTCCCAACATCAAAAAGCTGG + Intergenic
1161635198 19:5384200-5384222 GATTCCCAACAGCCAAAAGGTGG - Intergenic
925749329 2:7073262-7073284 GTTTCCCAACAGCCAAACGTGGG - Intergenic
931403143 2:61950322-61950344 GGTCCCCAACAACTAAACCCAGG - Intronic
935739083 2:106130805-106130827 GGTCCCCAACACCCTGAAGCAGG + Intronic
938368284 2:130753018-130753040 TATTCCAAAGAACCAAAAGCAGG + Intergenic
940006556 2:149013791-149013813 GGCTCCAAACAACCAAATGCTGG + Intronic
945035338 2:205699589-205699611 GGTACCCTGCAACCCAAAGCAGG - Intronic
948545647 2:238726820-238726842 GCTTCCCCACATCCAGAAGCCGG - Intergenic
1170591117 20:17772743-17772765 GGTTCCCATCTACCAAAGTCAGG + Intergenic
1172236372 20:33378620-33378642 ATTTCACAACAACCCAAAGCAGG + Intronic
1174653398 20:52148984-52149006 ACTTCCCAACAACCAAAAGGAGG + Intronic
1174831074 20:53812876-53812898 GCTGCCCAAAACCCAAAAGCCGG - Intergenic
1176377192 21:6092543-6092565 GCTGCACAACATCCAAAAGCAGG + Intergenic
1177357503 21:20028520-20028542 TGATACAAACAACCAAAAGCTGG - Intergenic
1177845749 21:26285475-26285497 TTTTCCTAAGAACCAAAAGCAGG - Intergenic
1178340146 21:31779127-31779149 GGTTCCCACCCACCAAATGCTGG + Intergenic
1178455436 21:32745813-32745835 GGTTGCAAACAACTAAAAACTGG + Intronic
1178511647 21:33210210-33210232 AGTTCTCAATAACCAAAAACTGG + Intergenic
1178538952 21:33433330-33433352 GATTCACAACAGCCAAAAGGTGG + Intronic
1179746283 21:43445701-43445723 GCTGCACAACATCCAAAAGCAGG - Intergenic
1181014170 22:20059308-20059330 TGTTTCCAACAGCCAAAAGGTGG - Intronic
1182492538 22:30683030-30683052 GGTTCCCAACAGGCACATGCTGG - Intergenic
1182791471 22:32956702-32956724 GGTTCGCAATAGCCAAAAGGTGG - Intronic
1184537443 22:45096815-45096837 TCTTCACAACAGCCAAAAGCTGG + Intergenic
1184926969 22:47649303-47649325 TGTTCCCAATAGCCAAAAGCTGG - Intergenic
950237068 3:11332098-11332120 TATTCTCAATAACCAAAAGCTGG + Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
955737503 3:62055067-62055089 AGTTCAGAACAACCAGAAGCAGG - Intronic
955875981 3:63490710-63490732 GGTGCCCATGAACCAAAATCAGG - Intronic
959044639 3:101459764-101459786 GATTCGCAATAACCAAAAGAGGG + Intronic
960475848 3:118127109-118127131 GGTAGCTAACCACCAAAAGCTGG - Intergenic
967009451 3:185418455-185418477 GGTTTGCACCAACCAAAACCTGG - Intronic
967784187 3:193471998-193472020 GGGTCCCAACATCCCACAGCGGG - Intronic
968264295 3:197350761-197350783 TATTCACAACAGCCAAAAGCTGG - Intergenic
969108689 4:4827953-4827975 TGTTGCCAACCACCAGAAGCTGG + Intergenic
971906799 4:32736450-32736472 GGATCCCAGCAAACAAAGGCAGG - Intergenic
972866983 4:43244734-43244756 GGTCTCCAACAAACAAAACCAGG - Intergenic
976986008 4:91298862-91298884 AGTTCCCAAAACCCAAAAGGGGG + Intronic
977195392 4:94052506-94052528 TATTCACAACAACCAAAAGGTGG + Intergenic
980089217 4:128424546-128424568 AGTTCCCAACATCCAGCAGCTGG + Intergenic
982912867 4:161166536-161166558 ATTTCCAAACAAACAAAAGCTGG + Intergenic
988170887 5:27653668-27653690 GGTTCCAAAGAACCAATATCAGG - Intergenic
990148154 5:52786906-52786928 GGATCACAGCAACTAAAAGCTGG - Intergenic
995181265 5:109232749-109232771 GGATCACAAAAAACAAAAGCTGG + Intergenic
997296326 5:132771216-132771238 GGTTGCCAACACACAAAAACAGG + Intronic
999140340 5:149357399-149357421 GCTTCCTAAAAACCAAAAGGCGG - Intergenic
999313243 5:150566892-150566914 TATTCACAATAACCAAAAGCTGG + Intergenic
1000064476 5:157683144-157683166 GGTTCCCAACAGGCACATGCTGG - Intergenic
1001516991 5:172362798-172362820 GGTAGCCAACTACCAGAAGCAGG - Exonic
1002004801 5:176223327-176223349 GGTTACAAATAAACAAAAGCAGG + Intergenic
1002221575 5:177687293-177687315 GGTTACAAATAAACAAAAGCAGG - Intergenic
1002768080 6:260573-260595 GATTCTCAACAGCCAAAAGATGG - Intergenic
1003416056 6:5909243-5909265 GATTCTAAAGAACCAAAAGCTGG + Intergenic
1005091612 6:22062568-22062590 GGTTCCAAAGATCCAAAATCAGG + Intergenic
1007698090 6:43746706-43746728 GTTTCCCAACCCCCAAAATCTGG + Intergenic
1009702283 6:67200617-67200639 GGCTCCCAGCAACCCCAAGCTGG - Intergenic
1012989291 6:105908499-105908521 GGTTCACAATAGCCAAAAGGCGG + Intergenic
1013303686 6:108828519-108828541 TCTTCACAACAACCAAAAGCTGG + Intergenic
1020227380 7:6290899-6290921 TGTTCACAATAACCAAAAGGTGG + Intergenic
1020946368 7:14613368-14613390 GGTTCACAAAAACTAAAAGTGGG + Exonic
1022385546 7:29895641-29895663 GCTTCCCAAGAAGCAAATGCTGG - Intronic
1022894758 7:34739163-34739185 CATTCCCAATAGCCAAAAGCTGG - Intronic
1023083996 7:36551724-36551746 TATTCACAACAACCAAAAGGTGG - Intronic
1023102023 7:36727459-36727481 AGTTCCCATCTACCAAAACCAGG + Intergenic
1039912183 8:41834359-41834381 GGTTCCCAACACCAGCAAGCTGG + Intronic
1041019612 8:53625535-53625557 TGTTCACAATAACCAAAAGATGG + Intergenic
1043608261 8:82029109-82029131 ATTTCCCAACAGCCCAAAGCTGG - Intergenic
1044159365 8:88894093-88894115 GGTTCCCAGAAACCAAGAGAGGG + Intergenic
1049993496 9:1011862-1011884 TGTTCACAACTACCAAAAACAGG - Intergenic
1050032602 9:1402110-1402132 ACTTCCCAACAAGCAAAAGATGG - Intergenic
1050623389 9:7477997-7478019 GGTTTGCACCAACCAAAACCTGG - Intergenic
1050624762 9:7491110-7491132 GGTCCCCAACAACCAGAAGAAGG + Intergenic
1054785626 9:69207476-69207498 TGTTCCCAACAGCCAAAACTTGG - Intronic
1054979452 9:71187717-71187739 GTTTCCCCATTACCAAAAGCTGG + Intronic
1057739932 9:97702243-97702265 TATTCACAATAACCAAAAGCTGG + Intergenic
1203363764 Un_KI270442v1:239682-239704 GGTTCCAGACAACCACAAGAAGG + Intergenic
1185626177 X:1483980-1484002 GGTTCCCCTAAACCCAAAGCTGG + Intronic
1185626206 X:1484092-1484114 GGTTCCCCTAAACCCAAAGCTGG + Intronic
1187666534 X:21617369-21617391 GGTTACCAACTACCAGAAGATGG + Intronic
1195753334 X:108178306-108178328 GCTTCTCCCCAACCAAAAGCAGG + Intronic
1198111631 X:133507433-133507455 TGTTCCCAATATCCAAAAGATGG + Intergenic
1198327714 X:135590557-135590579 TATTCACAACAACCAAAAGGTGG + Intergenic