ID: 909615803

View in Genome Browser
Species Human (GRCh38)
Location 1:77606569-77606591
Sequence GTGGCCACCACCACTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 3, 2: 7, 3: 23, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909615803 Original CRISPR GTGGCCACCACCACTGGGAC TGG (reversed) Intronic
900331133 1:2135159-2135181 GCGGCCGCCACCACCTGGACGGG + Intronic
900581501 1:3412040-3412062 CTGGACACGACCACGGGGACGGG + Exonic
900992179 1:6103200-6103222 GTGGCCAGCACCCCGGGGCCCGG - Exonic
906589104 1:47006983-47007005 GTAGACTCCACCACTGGGGCAGG + Intergenic
907238631 1:53068376-53068398 GTGGCCACAAGCACTGGCTCAGG - Intronic
908093143 1:60707372-60707394 GTGGCCACCACAGCTGGGACTGG - Intergenic
909615803 1:77606569-77606591 GTGGCCACCACCACTGGGACTGG - Intronic
912906680 1:113714858-113714880 GTGGCCATTAATACTGGGACTGG - Intronic
914455497 1:147833038-147833060 ATTGCCACCTCCACTGGAACAGG - Intergenic
914865806 1:151427879-151427901 TTGGACACCACCACTGGCCCAGG + Exonic
915593677 1:156884443-156884465 GGGGCCTCCAGCACTGGGATGGG + Intergenic
917404938 1:174696010-174696032 CTAGCCACCACAGCTGGGACTGG + Intronic
919065465 1:192688312-192688334 GTAGACACCACCTCTGGGGCAGG - Intergenic
921257658 1:213356998-213357020 GTGGGCACCAGCACAGGGAGGGG + Intergenic
921834183 1:219760812-219760834 GTGGCCAGGACCACTGGAATAGG - Intronic
1063462595 10:6224044-6224066 GTGGCCACCTTCAGGGGGACAGG - Intronic
1067687443 10:48475680-48475702 ATCGCCACCACCACTGGGCCAGG + Intronic
1070290964 10:75113110-75113132 GCAGCCAACACAACTGGGACAGG + Intronic
1074118317 10:110474477-110474499 GTGGCCACCAGAAGGGGGACTGG - Intergenic
1076227631 10:128792951-128792973 GTGGCCAGCAGCACTTGGACAGG - Intergenic
1077111162 11:862838-862860 GTGGGCACCACCTCTGGGGCCGG + Intronic
1077139754 11:1019042-1019064 GGGGCCACCACCACGGCCACAGG - Intronic
1077358290 11:2128571-2128593 GAGGCCAGCACCCTTGGGACAGG + Intergenic
1079183614 11:18215734-18215756 GTGGCCACAACCACTGTGACTGG - Intronic
1084091434 11:66881623-66881645 GTGCCCTCCTCCACTGGCACTGG - Intronic
1084760870 11:71270058-71270080 GTGGCCACAGCAACTGGGAGAGG - Intergenic
1085178556 11:74511854-74511876 GTGGCCATTACCACTGGGACTGG - Intronic
1087690944 11:101320220-101320242 GTGGCCATCACCACTGAGATTGG + Intergenic
1090187988 11:124750827-124750849 GTGGCCACCCCCACTGTGGGGGG + Exonic
1092136296 12:6149986-6150008 GGCGCCAGCACGACTGGGACTGG + Intergenic
1093001999 12:14007500-14007522 GCTGCCACCTCCACTGGAACAGG - Intergenic
1095390874 12:41705012-41705034 GTGCCCACCACCACCGCGCCTGG + Intergenic
1095941495 12:47730079-47730101 GGGGCAGCCACCACAGGGACTGG + Intergenic
1096707002 12:53428653-53428675 GAGGCCACATCCACTGGGTCTGG + Intronic
1098041102 12:66354898-66354920 ATGGCAATAACCACTGGGACTGG - Intronic
1098652645 12:72992510-72992532 GTGGTGCCCACCACTGGGAGAGG + Intergenic
1100223128 12:92528286-92528308 AGGCCCACCACCACTAGGACGGG - Intergenic
1102618990 12:114178685-114178707 GTGGCCAACACCACTGAAAAAGG - Intergenic
1104162402 12:126192528-126192550 GTGGCCACCACTTCTGTGCCAGG - Intergenic
1104660950 12:130611179-130611201 GCTGCCAACACCACAGGGACCGG + Intronic
1104846837 12:131851182-131851204 GTGGCAGCCACCAGTGGGCCTGG - Exonic
1107535389 13:41324516-41324538 CAGGCCCCCACCACTGGGTCTGG + Intronic
1111463411 13:88575986-88576008 GAGGCCTCCACCCCTGTGACAGG + Intergenic
1113204396 13:107898430-107898452 GTGCCCACCCACACTGGGAAGGG + Intergenic
1113618209 13:111695806-111695828 GTGGGCACCAGCAGTGGGGCAGG - Intergenic
1113623740 13:111781067-111781089 GTGGGCACCAGCAGTGGGGCAGG - Intergenic
1113907644 13:113827284-113827306 ATGGCCACCACCGATGGGACTGG - Intronic
1117042225 14:51777866-51777888 GTGGCCACCAGCACAGGCTCTGG - Intergenic
1118747702 14:68785929-68785951 GTGGCCACCACACATGGGCCTGG + Intergenic
1119428584 14:74551419-74551441 GTATCCACCACCCCTGGGCCAGG + Intronic
1123661984 15:22572569-22572591 GTGGCCGCCACCACAGTGCCTGG + Intergenic
1124262233 15:28202976-28202998 GTGGCCGCCACCACAGTGCCTGG - Intronic
1124315781 15:28666812-28666834 GTGGCCGCCACCACAGTGCCTGG + Intergenic
1128992477 15:72272455-72272477 GTGGCCGCCACCACGGGCACAGG - Exonic
1129561748 15:76577768-76577790 GTAGCCACCACAGCTGGGAATGG - Intronic
1130402880 15:83573802-83573824 GTGCCCACCACCACTGTAGCAGG - Intronic
1130650245 15:85758375-85758397 GTGGTCCCCACCACTGCTACAGG + Intergenic
1131314992 15:91328373-91328395 ATGGCCACCACCACTGTGCTGGG + Intergenic
1132038742 15:98506854-98506876 GCGGGCACCACCACTGAGTCTGG + Intronic
1133116293 16:3579555-3579577 GGGGCCACCAAAAGTGGGACAGG + Intergenic
1133916407 16:10113177-10113199 ATGGCCCCCACCCCAGGGACAGG + Intronic
1134417597 16:14057954-14057976 GTGGCCCCCACCCCTGGCTCTGG - Intergenic
1136500090 16:30665652-30665674 GCTGCCACCACGACTGGGGCCGG + Exonic
1136545073 16:30949955-30949977 GTGGCCACCTTCCCTGGGACGGG - Intronic
1139481255 16:67231951-67231973 ATGCCCACCACCAGAGGGACAGG + Intronic
1141990862 16:87608752-87608774 GTGGCCCCCACATCTGGCACAGG - Intronic
1143287295 17:5799823-5799845 GTGGCCACAACCCCAGGGAAAGG + Intronic
1146904927 17:36612188-36612210 ATGGCCCAGACCACTGGGACAGG - Intergenic
1149906352 17:60529532-60529554 GTGGCCACCCCCACTATGACTGG - Intergenic
1150314745 17:64159145-64159167 GTGGCAAGCACCTCAGGGACCGG + Intronic
1151048464 17:70948531-70948553 CCGGCCACCTCCACTGGAACAGG + Intergenic
1151679339 17:75615380-75615402 GCAGCCACCAGCTCTGGGACTGG + Intergenic
1152133092 17:78488974-78488996 CTGGCCTCCAGCACTGGGAGAGG + Intronic
1152421698 17:80196822-80196844 GTGGCCGCAATCACTGGCACTGG - Intronic
1152456925 17:80422032-80422054 GTCGCCACCACCACAGTGGCAGG + Intronic
1155142190 18:23053755-23053777 GCGGCTACCACCCCTGGGGCTGG + Intergenic
1157551657 18:48586042-48586064 GAGGCCACCACCCCTGCGACAGG - Intronic
1158517760 18:58145019-58145041 GCAGGCACCACCACTGGGCCAGG + Intronic
1159906604 18:74097868-74097890 CTTGCCACCTCCACTGGAACAGG + Intronic
1160845243 19:1163412-1163434 GTGGCCTCCAGGACAGGGACAGG + Intronic
1161087247 19:2340821-2340843 CTGCCCACCACCCTTGGGACCGG - Intronic
1161584720 19:5099087-5099109 GTGCCCAGCACTACTGGAACCGG - Intronic
1161658917 19:5533939-5533961 GTGGCCACCATCACAGGGGCCGG + Intergenic
1161683823 19:5693496-5693518 GTGGCCAGCAGCCCAGGGACTGG + Intronic
1162069902 19:8147376-8147398 GTGGCCAAGGCCGCTGGGACGGG - Exonic
1163689228 19:18729826-18729848 GTGGACACCACCTCTGGGGGAGG - Intronic
1164569779 19:29364902-29364924 GTGGCCACCCTCAGTGGAACTGG - Intergenic
1165154322 19:33778001-33778023 GTGGACAGCACCGCTGGGAGAGG - Intergenic
1165364792 19:35358879-35358901 GTGGCCACCACCATGGATACAGG + Exonic
1165366610 19:35371348-35371370 GTGGCCACCACCATGGATACAGG + Exonic
1165964291 19:39562652-39562674 GTGGTCACCACCACTATGACTGG + Intergenic
1166558953 19:43719399-43719421 GCGGCCGCCAGCCCTGGGACCGG - Exonic
925467545 2:4121538-4121560 GTGGCTACCACCACCACGACAGG + Intergenic
925754410 2:7119892-7119914 TGGGCCAACACCACTGGGAAAGG + Intergenic
928204979 2:29277596-29277618 GTGGCCAGCATCACTGGGGTTGG + Intronic
930255015 2:49080742-49080764 TTAGCCACCACCACTGGGAGGGG - Intronic
934605231 2:95690028-95690050 GTGGCCACCACCACTTTCTCTGG + Intergenic
934922089 2:98352674-98352696 GTGGCCACCAACACTGGGGAGGG - Intronic
936538682 2:113332567-113332589 GTGGCCACCACCACTTTCTCTGG + Intergenic
936885098 2:117300438-117300460 GTGGCCACGGCCACTGGGTGAGG + Intergenic
938339835 2:130528028-130528050 GTCCCCAGCACCACTGTGACCGG + Intronic
938350001 2:130592722-130592744 GTCCCCAGCACCACTGTGACCGG - Intronic
940443864 2:153753657-153753679 GTGGCCATTACCAATAGGACTGG + Intergenic
943719700 2:191191009-191191031 TTGGCCACCATCACTTGCACTGG + Intergenic
945431138 2:209767061-209767083 TTGGGCACCATCACTGGGAAAGG + Intergenic
947255961 2:228164021-228164043 GTGCCCACCCACACTGGGAGTGG - Intronic
948886236 2:240886417-240886439 GGGGCCACTTCCACGGGGACGGG + Intronic
1171371528 20:24665421-24665443 CTGTCCATCACCATTGGGACTGG + Exonic
1173126987 20:40346194-40346216 GTGGCCACCACCACTGGGGCTGG - Intergenic
1173189719 20:40866793-40866815 GTGGGGACCCCCACTGTGACTGG - Intergenic
1175910850 20:62404860-62404882 GTGGCCGGCATCCCTGGGACAGG - Intronic
1176385128 21:6135297-6135319 GTGGCCAAAGCCTCTGGGACAGG - Intergenic
1178880706 21:36447969-36447991 CTGGCAACCACCCATGGGACTGG + Intergenic
1179421202 21:41238251-41238273 GGGCTCACCACCACTGGGAAGGG - Intronic
1179504836 21:41833434-41833456 GTGCCACCCACCACTGGGAATGG + Intronic
1179505055 21:41834644-41834666 GTGCCACCCACCACTGGGAATGG + Intronic
1179688267 21:43066213-43066235 CTGGCCACCCCCTCTGGGCCTGG + Intronic
1179738345 21:43402955-43402977 GTGGCCAAAGCCTCTGGGACAGG + Intergenic
1179904467 21:44415186-44415208 GTGTCCACCTCCTCTGGGCCTGG + Intronic
1180034882 21:45241466-45241488 GCTGCCACCACCACTAGCACGGG + Intergenic
1180238039 21:46477115-46477137 GTGGGCACCTCCAGTAGGACCGG + Intronic
1182466561 22:30520454-30520476 GTGGCCCCCACCAAAGGGAGGGG - Intergenic
1183456727 22:37927018-37927040 GCAGCCACCAGCTCTGGGACAGG - Intronic
1183605459 22:38864934-38864956 GTGGCCTCTGCCACTGGCACGGG + Exonic
1184148923 22:42627473-42627495 GGGGCCAGGACCACTGGGCCTGG + Intronic
1185132158 22:49045369-49045391 GTGGCCGTGACCACGGGGACGGG - Intergenic
1185284618 22:49994703-49994725 GGTGCGACCACCGCTGGGACAGG + Exonic
1185368589 22:50448102-50448124 GTATACACCACCACTGGGAGGGG - Intronic
952555554 3:34526012-34526034 CTGGACACCACCACTGGGCAAGG + Intergenic
952946224 3:38479347-38479369 GTGGACACCTCCACAGGGAAGGG - Intronic
953493084 3:43366019-43366041 GTGGGCAGCACCACTGGGCAAGG + Exonic
954140633 3:48603367-48603389 CCTGCCGCCACCACTGGGACTGG - Intronic
956667127 3:71652534-71652556 GTGGCCAACCCCACAGGGCCTGG - Intergenic
956898047 3:73683938-73683960 GTGCCCACCACCACTGAGGGTGG + Intergenic
957291310 3:78281487-78281509 GCAGCAACCAGCACTGGGACTGG + Intergenic
957323069 3:78657136-78657158 GTGGCAGCCAGCACTGGGGCTGG - Exonic
957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG + Intronic
958452521 3:94291861-94291883 GTAGCCACAACCACTGGTTCAGG + Intergenic
958647041 3:96887471-96887493 CTGGCCACCTCCACTGGAACAGG - Intronic
959408958 3:105997176-105997198 GTGTCTACCACCACTGAGACTGG + Intergenic
961743056 3:129046112-129046134 GGGGTCGCCACCTCTGGGACTGG + Intergenic
963036084 3:141030434-141030456 GTGGCCCCCACCTCCCGGACGGG + Intergenic
964078631 3:152723712-152723734 ATGGCAACTACCACTGGGGCTGG - Intergenic
965434770 3:168636238-168636260 GTGGCCACCATGTCTAGGACTGG + Intergenic
967209125 3:187150891-187150913 TCGGCCACCTCCACTGGAACAGG + Intronic
967499683 3:190183455-190183477 GTTGCCACTAACACTAGGACTGG - Intergenic
967840930 3:194003867-194003889 GTGGCCACCACGGCGGGAACCGG - Intergenic
969635403 4:8366201-8366223 GTGGCCAGCGCCATGGGGACAGG + Intergenic
970442542 4:16094040-16094062 GTGGCCACCACCACTGAGACTGG - Intergenic
970520529 4:16879447-16879469 GTGCCCACCCCCACTGGGGAGGG - Intronic
971929431 4:33061129-33061151 GTGGCCACCACCAGAGGGCTCGG - Intergenic
973327340 4:48877237-48877259 GTGGCCACCACCACTGTCTGTGG + Intergenic
974764350 4:66322812-66322834 GAGGCCACCACCTCTAGGATTGG - Intergenic
976736090 4:88311850-88311872 GTGGCCACCACAGCTGGGAATGG + Intergenic
976750900 4:88450546-88450568 GTGGCCAGCACCACTGAAAATGG - Intergenic
977371949 4:96148687-96148709 GTGCCTGCCACCACTGGGCCCGG - Intergenic
979184638 4:117772786-117772808 GTGGCCACCACAGCTGAGAATGG - Intergenic
979736189 4:124088195-124088217 GTGGCCCAAACCACTGGGATTGG - Intergenic
982680092 4:158418771-158418793 CTGGCCACCTCCACTGGAACAGG - Intronic
983910282 4:173231445-173231467 GTGGCCACCAGCACAGGATCAGG + Intronic
985649590 5:1101196-1101218 CTGCCCACCTGCACTGGGACAGG + Intronic
985757966 5:1730468-1730490 GTGGTCACCTCCCCTGGGAGGGG - Intergenic
985824382 5:2181762-2181784 GTGTCCACCACCCCAGGGCCTGG + Intergenic
986285188 5:6353910-6353932 GTGGCCAGGACCACTCGGCCGGG + Intergenic
986740410 5:10700614-10700636 GTGCTCACCACCACTGTGCCTGG + Intronic
987079989 5:14417926-14417948 ATGCCTACCACCACTGGCACTGG + Intronic
994977361 5:106827336-106827358 GTGACTAACACCACTAGGACAGG - Intergenic
996659752 5:125988259-125988281 GTGGCCACTATAGCTGGGACTGG + Intergenic
998236236 5:140401110-140401132 GCAGTCACCACCTCTGGGACAGG - Intergenic
1000651223 5:163821547-163821569 ATAGCCACCACCACTATGACTGG + Intergenic
1001388187 5:171357266-171357288 GGAGCCACCACAACTGGGGCTGG - Intergenic
1002166149 5:177347838-177347860 GTGCTCACCACCACTGTGCCTGG - Intronic
1003124848 6:3348060-3348082 GTGTCCCCCACAGCTGGGACAGG - Intronic
1003506892 6:6747384-6747406 GTGGACACCACCAATGGGGTGGG - Intergenic
1003840264 6:10112636-10112658 TTGGCCAACAGCTCTGGGACTGG - Intronic
1004298234 6:14433705-14433727 GAAGCCACTACCACTGGGAGTGG - Intergenic
1005719958 6:28591272-28591294 GCAGCCACCAACACTGGGAGAGG + Intronic
1006874035 6:37279874-37279896 GTGGACTCCACCACAGGGAAAGG - Intronic
1006986457 6:38178766-38178788 GAGGCCACACCCAATGGGACAGG + Intronic
1008940621 6:57041574-57041596 GTGGCCACCAATACTGGGACTGG - Intergenic
1012584146 6:100902062-100902084 GTGACCACCACAACTGGCAAGGG - Intergenic
1016058667 6:139605340-139605362 AAGGCCAGCACCAATGGGACGGG - Intergenic
1018298776 6:162377676-162377698 GGGGCTGCCAGCACTGGGACAGG + Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019516297 7:1441643-1441665 CTGGACACCACCAGGGGGACAGG + Intronic
1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG + Intergenic
1022080317 7:27013282-27013304 GTGGCCACCACCATTATGACTGG - Intergenic
1022411629 7:30142973-30142995 GTGGCCACGCCCAGTGGCACAGG + Intronic
1024226140 7:47328098-47328120 GGGGACGCCACCGCTGGGACAGG - Intronic
1033867679 7:145713031-145713053 GTGACCACCACCACTGGGACTGG + Intergenic
1034272285 7:149809078-149809100 GTAGCCACCACCACAGGGCACGG - Intergenic
1034282406 7:149863413-149863435 GTGGTCACCAGAAATGGGACTGG + Intronic
1035517760 8:250979-251001 CTGACCACCCCCACTGGAACAGG - Intergenic
1036619137 8:10411911-10411933 GTGGACACCGCCCCTGGGAAGGG + Intronic
1037420175 8:18693653-18693675 GTTGCCACCACAACTGCAACAGG - Intronic
1037786134 8:21904326-21904348 CTGGCCACCCCCACTGTCACAGG + Intergenic
1038012705 8:23487437-23487459 CTGGCCACCAACCCTGAGACTGG - Intergenic
1039903691 8:41770892-41770914 CAGGCCACCACACCTGGGACTGG - Intronic
1040590425 8:48787850-48787872 GGAGCCAGCTCCACTGGGACAGG - Intergenic
1040671026 8:49691070-49691092 CTTGCCACCTCCACCGGGACAGG - Intergenic
1041202216 8:55461030-55461052 GTAGGCTCCACCTCTGGGACAGG + Intronic
1041790714 8:61693591-61693613 ACGGCCACCACCACTGGGGAAGG + Intronic
1043388351 8:79768644-79768666 GTGGCCACCAGCCCAGGGGCCGG + Intergenic
1043516059 8:80996189-80996211 CTGCCCACGACCACGGGGACTGG - Intronic
1043740097 8:83800950-83800972 GTGGCCACCATCACTGATATTGG + Intergenic
1043743315 8:83842070-83842092 CTGGAGACGACCACTGGGACAGG - Intergenic
1044681429 8:94782210-94782232 TGGGCCAGCTCCACTGGGACTGG + Intronic
1045541402 8:103089583-103089605 GTGGAAACCAGCACTGGCACAGG + Intergenic
1047342669 8:123998472-123998494 GTTGCTACCACCACTGGGACTGG + Intronic
1049103131 8:140593685-140593707 ATGGCCACCACCATTGTGTCAGG + Intronic
1051454750 9:17242451-17242473 GTATGCACCACCACTGGGCCTGG + Intronic
1055346928 9:75349753-75349775 CTCGCCACCTCCACTGGAACAGG - Intergenic
1056634487 9:88320389-88320411 GTGGCTACCAAGACTGGGCCAGG + Intergenic
1056799265 9:89680126-89680148 GTGGCCACCACCACAGTGCCCGG - Intergenic
1057844782 9:98514991-98515013 GTGGCCTCCCCCACTGGAACTGG - Intronic
1059886702 9:118752050-118752072 GTGGTCACAACCACTGAGACTGG - Intergenic
1060710625 9:125860312-125860334 GTGGCCAACCCCAAGGGGACAGG + Intronic
1062126231 9:134864467-134864489 GTGGCCATCCCCACTGGGGTTGG + Intergenic
1062168769 9:135122609-135122631 GTGGCCACCCCGACTGGGAGAGG - Intergenic
1062285447 9:135770682-135770704 GTCCCCAACACCTCTGGGACGGG + Intronic
1186723039 X:12326475-12326497 GTGGCCATCACAACTGGGGGTGG - Intronic
1187249082 X:17580926-17580948 GTAGCCAGGACCACTGGGGCGGG + Intronic
1196619715 X:117807706-117807728 GTAGCTACCACCACTGGGACTGG - Intergenic
1197272189 X:124436789-124436811 GTGGCCACCATCTCTCCGACTGG - Intronic
1197363109 X:125532153-125532175 GTGGCCACCACCACTATGGCAGG + Intergenic
1197391811 X:125877294-125877316 GTTGCCACCAACACTAGGATAGG + Intergenic
1197433818 X:126400431-126400453 GGGGCCACCAGCAGTGGGGCTGG + Intergenic
1197773604 X:130106229-130106251 GAGGCCAGCACGGCTGGGACTGG - Intronic
1198785359 X:140282757-140282779 GTGGCCACCATCACTAGGACTGG + Intergenic
1199516689 X:148685217-148685239 GGTGCTACCTCCACTGGGACAGG + Intronic
1200746796 Y:6910599-6910621 GCGGTGACCACCACTGGGAGCGG - Intergenic
1200798269 Y:7361778-7361800 CTGGCTTCCACGACTGGGACTGG - Intergenic
1201909006 Y:19114511-19114533 GTAGGCTCCACCTCTGGGACAGG - Intergenic