ID: 909617545

View in Genome Browser
Species Human (GRCh38)
Location 1:77628650-77628672
Sequence AAGCTGAACACTAGGATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909617543_909617545 18 Left 909617543 1:77628609-77628631 CCTTATATGGGATATCTTTGCAC No data
Right 909617545 1:77628650-77628672 AAGCTGAACACTAGGATAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909617545 Original CRISPR AAGCTGAACACTAGGATAGA AGG Intronic
907016186 1:51015598-51015620 AAGCCTACCACTAGGATATAGGG + Intergenic
907770353 1:57455784-57455806 CAGCTGAAGATTAGGAGAGAGGG - Intronic
909617545 1:77628650-77628672 AAGCTGAACACTAGGATAGAAGG + Intronic
910197209 1:84654342-84654364 AAACTAAACACTAGGAGAAATGG + Intronic
911300284 1:96164502-96164524 AAGCTGAAAACTAAGAAATAAGG - Intergenic
913271242 1:117095655-117095677 AAGCTGAGTACTTGGATACAAGG + Intronic
915682582 1:157595826-157595848 TTGCTGACCAGTAGGATAGATGG + Intronic
916353689 1:163880725-163880747 AAGCTGAACAGTGGGAAAGAAGG + Intergenic
917334366 1:173913072-173913094 AAATTGACCACTAGAATAGAAGG + Intronic
918803590 1:189007553-189007575 AAGATGAACTCTAGTATGGAAGG + Intergenic
919862272 1:201748003-201748025 CAGCTCAACACTAGCCTAGAAGG - Intronic
923515491 1:234694622-234694644 AAGCTGAACATCAGGAGTGAGGG - Intergenic
923544626 1:234915108-234915130 AAGCTGAAGACGAGGATGCATGG - Intergenic
1063521514 10:6745680-6745702 GAGTTGAACACTGGGTTAGAAGG + Intergenic
1063725477 10:8632890-8632912 AAGCTGTACAATTGGAGAGAAGG + Intergenic
1065967232 10:30780153-30780175 TGGCTGAACATCAGGATAGATGG + Intergenic
1068177765 10:53484527-53484549 AAGGAGAAGACTAGGATTGAGGG - Intergenic
1068329061 10:55538159-55538181 AAGTTGAATCCTAGGATACAAGG - Intronic
1071406430 10:85338056-85338078 AGGCTGGACACTAGGAAAGGAGG + Intergenic
1071707064 10:88010721-88010743 AAGCTGAGCACTGAGGTAGAAGG + Intergenic
1073872658 10:107883173-107883195 AATCTGAACACATGGATAGTGGG + Intergenic
1075024371 10:118973532-118973554 AAGCTTCCCACTAGGAAAGAGGG + Intergenic
1082347723 11:51459113-51459135 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082347780 11:51459962-51459984 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082354015 11:51549910-51549932 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082368410 11:51759890-51759912 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082428163 11:52626403-52626425 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082493317 11:53567217-53567239 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082496127 11:53608029-53608051 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082496536 11:53613982-53614004 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082497532 11:53628418-53628440 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082536798 11:54197052-54197074 GAGCTGAACATTAGTTTAGATGG + Intergenic
1082541357 11:54262689-54262711 GAGCTGAACATTAGTTTAGATGG + Intergenic
1085662227 11:78378948-78378970 AACCTGAAGCTTAGGATAGATGG + Intronic
1086458641 11:86984034-86984056 ATGATGAACACTAGGAGGGAAGG + Intergenic
1089700920 11:120243275-120243297 AAGATGGACACTAGGAGAGAGGG + Intronic
1094665664 12:32518229-32518251 AAGATGAACACTTGGAGAGCAGG + Intronic
1098049253 12:66436180-66436202 AAGCAGACCACTTGGAAAGAAGG - Intronic
1098803394 12:74990061-74990083 CATCAGAACACAAGGATAGAAGG - Intergenic
1107825087 13:44321850-44321872 AAGCTGAAGACCAGGAAAGCTGG + Intergenic
1109849752 13:68046251-68046273 AAATTGGAGACTAGGATAGATGG + Intergenic
1112400547 13:99073693-99073715 AAAGTGAACACCAGGATTGAAGG - Intronic
1112451637 13:99516675-99516697 AAGCTCAACAACAGGGTAGAGGG - Intronic
1116029585 14:39554751-39554773 AAGCTGACAACTAGGAAAGAAGG + Intergenic
1116396580 14:44454298-44454320 AAGCTGAATACTTGGATTCAAGG + Intergenic
1116553366 14:46271082-46271104 AGGCTGAGTACTAGGAAAGAAGG + Intergenic
1116748819 14:48855590-48855612 AAGCTTAACACTAGGAAATAGGG - Intergenic
1118970816 14:70636026-70636048 AAGGTGAAGATTAGGAAAGAAGG + Intergenic
1120813615 14:88830236-88830258 ATGCTGAACCCTAGGGTGGAAGG + Intronic
1125796215 15:42405827-42405849 AAGCTAAAGACCAGGATACAGGG + Intronic
1128254369 15:66186047-66186069 AAGCTGAACCCTATGAAGGAAGG - Intronic
1134876590 16:17705332-17705354 AGGCTGAACACAGGGATAGCAGG + Intergenic
1146545097 17:33731512-33731534 CAGCAGAACTCTAGCATAGATGG - Intronic
1148114665 17:45168678-45168700 AAGAAGAAAACTGGGATAGAAGG - Intronic
1150983646 17:70170514-70170536 AGGATGATCACTAGGATAAAAGG + Intronic
1154389158 18:13921755-13921777 AAACTAAATACAAGGATAGAGGG + Intergenic
1154965430 18:21351163-21351185 AAGCAAAACAGTAGAATAGAGGG - Intronic
1164776232 19:30855733-30855755 AAGTTGAATTCTAGGAGAGATGG + Intergenic
1167416558 19:49376267-49376289 AAGATGAAGACAAGGATAGGTGG - Intergenic
925815386 2:7742635-7742657 AAGCAAAACACAATGATAGAAGG + Intergenic
932462355 2:71891216-71891238 GAGCTGACCTCCAGGATAGATGG + Intergenic
934725089 2:96611374-96611396 TGGCTGAACCATAGGATAGAAGG + Intronic
934902069 2:98167409-98167431 ATGCTGAACACTAAGAATGAAGG + Intronic
935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG + Intergenic
936751010 2:115641529-115641551 AAACAGGATACTAGGATAGAGGG - Intronic
938924291 2:136025038-136025060 ATGCTGAACACAAGGATATGGGG + Intergenic
941011416 2:160304092-160304114 AAGCTGAACTCAAGAGTAGATGG + Intronic
941567322 2:167125701-167125723 AAGCTGAACAATAGGAAATATGG + Intronic
941612826 2:167682670-167682692 AAGAAGGACACTAGGACAGAGGG - Intergenic
941680658 2:168395009-168395031 AAGCTCCACACAAGGTTAGATGG - Intergenic
943162214 2:184269099-184269121 AAACTGAACACTAAGGGAGATGG + Intergenic
944263483 2:197699204-197699226 AAGGAGAACACTGGGACAGAGGG - Intronic
946894500 2:224309779-224309801 AGGCTGAGAACTAGGACAGATGG - Intergenic
1168849839 20:968983-969005 AAGCTGAACACTTGCAGGGAGGG + Intronic
1169270245 20:4193649-4193671 AAGCTGAACAGTATGAAACAGGG - Intergenic
1170858663 20:20081986-20082008 AATCTGAACATGTGGATAGAGGG - Intronic
1171038180 20:21733750-21733772 AAGTTGATCACTTGGTTAGATGG + Intergenic
1172949453 20:38713385-38713407 TTGCTGAGCACCAGGATAGAAGG + Intergenic
1174090287 20:48041546-48041568 ATGCTGAACACCAGCACAGAGGG + Intergenic
1183792792 22:40087313-40087335 ATCCTGAACACTGGGAAAGAAGG - Intronic
951971536 3:28450678-28450700 AAGCAGACCACTAAGATATATGG - Intronic
952034461 3:29182568-29182590 AAGGTGAACACTATGATAAAAGG + Intergenic
959025482 3:101235808-101235830 CAGCTTAAAACAAGGATAGATGG + Intronic
960660315 3:120050845-120050867 AACCAGATCACTAGGGTAGAAGG + Intronic
961073831 3:123963456-123963478 TTGCTGATCACTAGCATAGAGGG + Intergenic
961856566 3:129877351-129877373 AAGATGAGAACTAGGTTAGAGGG - Intronic
962039234 3:131687660-131687682 GAGCTGAAGACTAGGATGGCTGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964370580 3:155995997-155996019 AGCCTGAGCACTAAGATAGAGGG + Intergenic
965377617 3:167944979-167945001 AATCTGAACACTAAAATAAAAGG + Intergenic
967028804 3:185586785-185586807 AGGCTGAACACTAACATTGAAGG + Intronic
969318658 4:6397091-6397113 AGGTTGAACACTGGGATTGAAGG - Intronic
971785735 4:31099965-31099987 ATGCTGAACAGAAGGAAAGAAGG + Intronic
972964350 4:44491108-44491130 ATGAAGAACACTAAGATAGAAGG - Intergenic
973719655 4:53710537-53710559 CAGCTGAAAACTTGTATAGATGG - Intronic
981740475 4:147996347-147996369 AAGATGAACCCTGAGATAGAGGG + Intronic
983503382 4:168526108-168526130 AAGCTGAACTCTATGCTGGAAGG - Intronic
986678546 5:10212093-10212115 AACCAGTACATTAGGATAGAAGG + Intergenic
987877941 5:23704873-23704895 AAGCTGAAGATTAGGAATGATGG + Intergenic
988445888 5:31285403-31285425 AAGCTGGAGAATAGCATAGAAGG - Intronic
988868952 5:35366968-35366990 AAGGAGACCACTAGGATACAGGG + Intergenic
992569325 5:78038721-78038743 AAGCTGACCAGGAGGAGAGATGG + Intronic
995654852 5:114414257-114414279 AAGCTTAACATTATAATAGAAGG - Intronic
995832252 5:116366148-116366170 TTGCTTAAGACTAGGATAGATGG + Intronic
997767054 5:136515111-136515133 GTTCTGAACAATAGGATAGATGG + Intergenic
998483064 5:142479130-142479152 AAGGTGAACAATAGGATGGAAGG - Intergenic
1000046430 5:157525518-157525540 AACCTGAACATTAGGAGAGCTGG - Intronic
1001457066 5:171871465-171871487 ATGCTGAATACTGGGATTGACGG + Intronic
1002759930 6:193465-193487 TGGCTGAAGACTAGGAGAGATGG + Intergenic
1003216086 6:4113885-4113907 AATGTGAACACTTGGACAGAAGG - Intronic
1003934032 6:10957159-10957181 AAGCTGAAAAAGAGGAAAGAAGG + Intronic
1004956772 6:20736079-20736101 GAGCTGAGCACTGGGATAGAAGG - Intronic
1005329457 6:24735270-24735292 CAGCTGAACAGAGGGATAGATGG + Intergenic
1005445639 6:25919748-25919770 AAGCTATGCAATAGGATAGATGG + Intronic
1005794350 6:29342387-29342409 AAGCAGAGGACTTGGATAGAGGG + Intergenic
1007056138 6:38887122-38887144 GAGCTAAACACTAGGAAAGAGGG + Intronic
1008458091 6:51735582-51735604 AAGGAGAAAACTTGGATAGAGGG + Intronic
1010111953 6:72247275-72247297 AAGATCAAAACTAAGATAGATGG + Intronic
1014639811 6:123895086-123895108 CAGCAGAACAGTAGGACAGAGGG - Intronic
1015162010 6:130163523-130163545 AAGCTGCACACTTGGAAACATGG - Intronic
1015971790 6:138749726-138749748 AAGCTGAACACGGGGGGAGAAGG + Intergenic
1016452804 6:144200844-144200866 AAGATGGTCAGTAGGATAGAAGG - Intergenic
1016863416 6:148744235-148744257 AAGCCAAACAGAAGGATAGAAGG + Intergenic
1026387822 7:69868222-69868244 AAGCTGAATCCTAGGATAAATGG - Intronic
1027125839 7:75556175-75556197 AAGGTGACCACAAGGAAAGAGGG + Intronic
1030580377 7:111347582-111347604 AAGAGGAACAGTAGGAAAGAGGG + Intronic
1032571501 7:133004507-133004529 AACCTGACCTCTAGGCTAGATGG - Intronic
1034368029 7:150568936-150568958 AAGCTGGGCACTAGGTTGGAGGG + Intronic
1039329067 8:36516373-36516395 AAGCTGTCCACTAGGACAGGAGG + Intergenic
1039781118 8:40786773-40786795 ATTCTGGACCCTAGGATAGATGG + Intronic
1044710526 8:95053124-95053146 GACCTGAACACTAAGACAGAGGG - Intronic
1050237346 9:3595913-3595935 AAGTTGATCACTTGGATGGATGG - Intergenic
1055654700 9:78440631-78440653 AAGCAGAACAATAGGAGAGTAGG + Intergenic
1058636673 9:107044695-107044717 AAGGTGAGCTCTAGGAGAGAAGG + Intergenic
1186280737 X:7989875-7989897 CAGCTGAAGAATAAGATAGAAGG + Intergenic
1187521357 X:20017458-20017480 AAGCTGACCATTAGGATGGATGG - Intronic
1190939396 X:55026073-55026095 AAGCTGAAGACGAGGATCAAAGG - Intronic
1194307684 X:92268786-92268808 AAGCATGACACTAGCATAGATGG - Intronic
1199779724 X:151047052-151047074 AAGCTGAACACTTTGATAGTTGG - Intergenic