ID: 909619944

View in Genome Browser
Species Human (GRCh38)
Location 1:77656391-77656413
Sequence TTCTTAAGACAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909619944_909619947 19 Left 909619944 1:77656391-77656413 CCATGCTCCATCTGTCTTAAGAA 0: 1
1: 0
2: 0
3: 19
4: 199
Right 909619947 1:77656433-77656455 ACACAACAATCAAAAAGACTAGG 0: 1
1: 0
2: 0
3: 41
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909619944 Original CRISPR TTCTTAAGACAGATGGAGCA TGG (reversed) Intronic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
901414338 1:9106344-9106366 TTCTCAACACAGAAGCAGCAGGG + Intronic
901498294 1:9635479-9635501 TTCTTTAGACACCTGGAGCGTGG - Intergenic
901674852 1:10877156-10877178 TTCTTGAGGCAGAAGGAGGAGGG + Intergenic
902184069 1:14711982-14712004 TTCTGAGTACAGAAGGAGCATGG + Intronic
905957008 1:42005608-42005630 ATCTTCAGAAAGATGCAGCATGG - Intronic
906642940 1:47452390-47452412 TTCTCAAGACAAAAGGAGCTTGG + Intergenic
906840420 1:49132618-49132640 TTCATGATACAGATCGAGCAGGG + Intronic
907940005 1:59078396-59078418 TACTTAAGAAAGAAAGAGCAAGG - Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908991317 1:70094022-70094044 TTCTTCCCTCAGATGGAGCAAGG - Intronic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
909891270 1:81010171-81010193 TTAAAAAGACAGAAGGAGCAAGG + Intergenic
912903238 1:113675391-113675413 TTCGTAGTACAGATGGGGCAAGG - Intronic
918145060 1:181748653-181748675 TCCTTAAGACAAATGTAGCCTGG + Intronic
920098079 1:203499547-203499569 ATCTTGAGAGGGATGGAGCAAGG + Intronic
920258287 1:204671571-204671593 TTCTTAAAAATGATGGACCATGG + Intronic
920711424 1:208298934-208298956 TGCTTAAGAGAGATGGGGCTGGG + Intergenic
923696170 1:236254586-236254608 ATCTTGAGACATAGGGAGCATGG - Intronic
923747753 1:236718471-236718493 TTATGAAGACAGATGGATCAGGG - Intronic
923785225 1:237060366-237060388 TACTTAAGAAAGATTTAGCAGGG - Intronic
1064451121 10:15442828-15442850 TTTTTAAAACAGGTGGAGCATGG - Intergenic
1065859674 10:29861493-29861515 GACTTAAGACAGATGTAGCCAGG - Intergenic
1066538072 10:36412904-36412926 TACTTTAAACAGATGGTGCATGG - Intergenic
1067333038 10:45339340-45339362 TGCATAAGACAGATGGATCTTGG + Intergenic
1070614493 10:77958932-77958954 TTTTAGAGTCAGATGGAGCAGGG + Intergenic
1073474706 10:103745329-103745351 TTCTTAAGCCAGATTGAGATGGG + Intronic
1078926577 11:15880713-15880735 TTCTTAAGAGTGAGGGAGCTGGG - Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1080020242 11:27552558-27552580 TGCAGAAGACAGATGGAGCTTGG - Intergenic
1080260443 11:30343816-30343838 TCCTTTAGACAAATGTAGCATGG + Intergenic
1081693469 11:45094000-45094022 TCCTCAAGACAGCTGGAACAAGG - Intergenic
1083058394 11:59845156-59845178 TTATTAAGAGAGATGGGGCCAGG - Intronic
1087689501 11:101303372-101303394 TTCTTTAGACAGCTGTATCATGG - Intergenic
1092897655 12:13028902-13028924 TTCTGAAGCCAGAGGGAGCAAGG - Intergenic
1093049032 12:14485854-14485876 TGCAGAAGACAGATGGATCATGG - Intronic
1093049779 12:14491863-14491885 TGCAGAAGACAGATGGATCATGG - Intronic
1094317003 12:29145994-29146016 TTCTGAAGGCAGATGCAGCACGG - Intergenic
1096605944 12:52766607-52766629 CTCATAAGACAGAAGCAGCAGGG - Intergenic
1096719684 12:53511931-53511953 TTCTTAGGACAGAAGGAACAGGG - Intronic
1096986395 12:55761466-55761488 TTCTTAAAACAGGTGAATCAAGG + Intronic
1098578779 12:72074321-72074343 TTCTGGAGACAGATGGACCTGGG + Intronic
1098810023 12:75075865-75075887 TTCTTAAGGCAGGTGGAGATAGG - Intronic
1100116136 12:91306615-91306637 TATTTAAGACATATGGAGGAAGG + Intergenic
1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG + Intronic
1102705053 12:114874086-114874108 CTCTTAAGAAAGATGGTGCCGGG + Intergenic
1102743932 12:115233151-115233173 TTCTAAAAACAGATGGTACAGGG + Intergenic
1102760860 12:115383710-115383732 TACTGAGGGCAGATGGAGCAAGG + Intergenic
1103855566 12:123967385-123967407 TTGATAAGAAAGATGGAGAAAGG - Intronic
1104760606 12:131295649-131295671 TTCCTCAGTCAGATGGAGGAGGG - Intergenic
1105561502 13:21496724-21496746 TTTTGAAGTCAGATGGACCAAGG - Intronic
1108675873 13:52737292-52737314 TACTTAAGTCATATGGATCAGGG + Intronic
1108914404 13:55589787-55589809 TGCTGAAGACAGATGGATCTTGG - Intergenic
1109593874 13:64524081-64524103 TCCTAAAGCCAGATGGAGAAAGG + Intergenic
1111279247 13:85997675-85997697 ATCTTCAGAAAGATGCAGCATGG - Intergenic
1111470957 13:88681959-88681981 TTCTTAAAACAGATGGATCTTGG - Intergenic
1112857999 13:103794385-103794407 TGCTTCTAACAGATGGAGCAGGG - Intergenic
1114620127 14:24090827-24090849 AGCTTTAGGCAGATGGAGCAAGG - Intronic
1116531557 14:45979104-45979126 TGCAGAAGACAGATGGATCATGG - Intergenic
1117729934 14:58712249-58712271 TTCTTAACAAAGAGGTAGCAAGG - Intergenic
1118669697 14:68110408-68110430 ATCTTGAGACAGATGGAGAAAGG - Intronic
1118818141 14:69327021-69327043 TTCATAAGGCAGAGGTAGCAGGG + Intronic
1120656302 14:87194038-87194060 TTCTTATGCCAGACTGAGCAGGG + Intergenic
1120738409 14:88080722-88080744 TTCTTTAGAGAGATGCAGTAGGG - Intergenic
1120943877 14:89975879-89975901 TTCTTAGGAGAGACTGAGCATGG + Intronic
1122372097 14:101234483-101234505 TTTGTAAGACAGAGGGAGGATGG + Intergenic
1123902344 15:24889615-24889637 TTCTTAAGAGAGGTGAACCAGGG + Intronic
1124689474 15:31810104-31810126 TTCTTCAGGCAGCTGGAGAAGGG + Intronic
1125438854 15:39679180-39679202 CTTTTAAGAAAGATGGAGAATGG + Intronic
1128028076 15:64456105-64456127 TTCTTAAAAAAGAGAGAGCAAGG + Intergenic
1128582233 15:68818375-68818397 TTCTTAAGACAAATGGCTCCCGG - Intronic
1133012385 16:2921367-2921389 TTCTAAAGCCAGAGGGAGGATGG + Intronic
1133661410 16:7921512-7921534 TGCTTAAGGCAGTTGGAGCTGGG + Intergenic
1136108451 16:28048915-28048937 TTTTTAAAAAAGATGGAGGAGGG + Intronic
1137521660 16:49200379-49200401 TCCTTCAGACAGAGGGAGAAAGG - Intergenic
1137695296 16:50457608-50457630 GACTAAAGACAGAAGGAGCATGG + Intergenic
1138627291 16:58262452-58262474 TTCTTGAGACAATTGAAGCAAGG + Exonic
1138647170 16:58434108-58434130 TTCTTAGGCCAAATGGAGAAAGG - Intergenic
1140406073 16:74712433-74712455 TTCCTAAAACAGAGGGAGAAAGG - Intergenic
1140863483 16:79039666-79039688 TTCTTAAGAAAGATGGCACAAGG - Intronic
1142478967 17:206382-206404 TTCTTACGGCAGCTGGAGGAAGG + Intergenic
1142873442 17:2836251-2836273 TTCTTAAGCCAGTTTGAGTAAGG - Intronic
1144123266 17:12177590-12177612 TTCTTAAGCCAGATGGTGGTGGG + Intergenic
1146448537 17:32952942-32952964 TTCATAAGACAAATGGGGCTGGG - Intergenic
1146630139 17:34463763-34463785 TGCTTGAGCCAGGTGGAGCAGGG - Intergenic
1146839571 17:36141097-36141119 TTATCAAGACAGATTGTGCATGG + Intergenic
1147052009 17:37802329-37802351 TGCTGAAGACAGATGGAGAGAGG + Intergenic
1149441034 17:56674005-56674027 ATGGTAAGAAAGATGGAGCACGG + Intergenic
1150816014 17:68392344-68392366 TTTTTAAGTCATATGGTGCAAGG - Intronic
1150873303 17:68939747-68939769 TTCTTAAGACAGATTGAGTTGGG + Intronic
1152500731 17:80707212-80707234 TTCTGAAAACATCTGGAGCATGG - Intronic
1155405647 18:25483965-25483987 TGCTTGAGATAGATGGAGAATGG - Intergenic
1156039705 18:32806757-32806779 TTCCTAACACCTATGGAGCAGGG - Intergenic
1158278773 18:55797821-55797843 TTTAAAAAACAGATGGAGCAAGG - Intergenic
1158572452 18:58608561-58608583 TTCCTAAGACAGATTAAGAATGG - Intronic
1159440604 18:68475171-68475193 ATTTTGAGACAGATGCAGCATGG - Intergenic
1161958817 19:7511527-7511549 TCCTTGAGCCAGATGGAGCTTGG - Intronic
1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG + Intronic
1163431055 19:17267912-17267934 TCCTTAAGCCAGATTGAGTAGGG - Intronic
1163739148 19:18999999-19000021 AACTTAAGACAGTTGGACCAGGG - Intronic
1164782360 19:30903247-30903269 TATTTAAGACAGATGGAGTCAGG - Intergenic
1165209107 19:34218316-34218338 TTTTTAAGACAGAAGGATCATGG + Intronic
925814372 2:7733148-7733170 TTCATCAGAAAGATGGAGAATGG - Intergenic
925878434 2:8331294-8331316 TTCTAAAGCCAGATAGAGCCGGG + Intergenic
926996408 2:18740694-18740716 TTCTTGAGACAGCTGGAGGGCGG - Intergenic
927075553 2:19573665-19573687 TTCTCAAGGGAGAGGGAGCAGGG - Intergenic
928228505 2:29475980-29476002 TGCTTCGGACAGATGGGGCAGGG + Intronic
929067739 2:37996896-37996918 TCCTCAAGCCAGAAGGAGCAGGG - Intronic
929229289 2:39542616-39542638 GCCTTAAACCAGATGGAGCATGG + Intergenic
930342066 2:50129578-50129600 ATATTAGGACACATGGAGCATGG - Intronic
930707642 2:54520455-54520477 TTCTTCAAACAGGTGGATCAAGG - Intronic
931077732 2:58735341-58735363 TTCTTGAGGCAAATGGAGAAGGG + Intergenic
932499723 2:72173240-72173262 TTCTTAAAGCTGATGGAGTAAGG - Intergenic
937745987 2:125415946-125415968 TTCTTATGACAAATGAAGGAAGG + Intergenic
937852672 2:126649623-126649645 TGCAGAAGACAGATGGAGCTTGG - Intergenic
940184994 2:150974321-150974343 TTGTTAAGACAGCTTGAGCAGGG - Intergenic
942290521 2:174465473-174465495 TACTGAAGGCAGATGGAGAAAGG - Intronic
944931498 2:204524890-204524912 TTCTTAAGATAAAAGGAGCATGG - Intergenic
946590277 2:221239544-221239566 TTCTTAAGTCTGAAGGAGTAAGG + Intergenic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1170956370 20:20983698-20983720 TTCTTGAGACCGTTGGAGAAGGG - Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1176111693 20:63413835-63413857 TTCCTAAGCCAGGTGGAGCCCGG + Intronic
1180865771 22:19118847-19118869 TTCTCTACACAGATGGAGAAAGG + Intronic
1182773899 22:32816905-32816927 TTCTTAAGATTGGTGGTGCAAGG - Intronic
1182951447 22:34380073-34380095 ATCATGAGACAGATGGAGCTTGG - Intergenic
953958014 3:47246350-47246372 TTCTCGAGACAGATGGTCCAGGG - Intronic
956585010 3:70854909-70854931 ATCTTGAGGCAGAAGGAGCAAGG + Intergenic
958257588 3:91342644-91342666 TTCTTGAGGCAGATGGGGAAAGG + Intergenic
959979592 3:112500858-112500880 TTCTTGAGGCAGCTGAAGCAAGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
960631299 3:119734075-119734097 TTGTTAAGACACATGCAGCTGGG + Intronic
961834834 3:129648973-129648995 TTCCTAAGACAGTTTGAGAAAGG + Exonic
964497330 3:157305404-157305426 TTTTTAAGACAGATAGAGGCCGG - Intronic
965146360 3:164910769-164910791 TGCTTAAGAAAGATGAATCAAGG - Intergenic
966052276 3:175634369-175634391 TTCTTAAGATTCTTGGAGCATGG + Intronic
967540546 3:190662308-190662330 CTCTTCAGATAGATGGATCAAGG - Intergenic
971778048 4:30993377-30993399 TTCATTAGACGTATGGAGCATGG - Intronic
972275890 4:37557531-37557553 TTCATAAGGCAGATGGGGCGAGG + Intronic
972958629 4:44423618-44423640 TTCTAAAGACAAATGGAGGGTGG + Intronic
975384488 4:73739761-73739783 TTCCAAAGGCAGTTGGAGCAAGG - Intergenic
977204584 4:94154699-94154721 TTCAGAAGACAGATGGATCTTGG + Intergenic
978282483 4:107035326-107035348 TTCTTCAGACAGAAGAGGCAGGG - Intronic
978805085 4:112791307-112791329 TTCTTGAGTCTGAAGGAGCAAGG + Intergenic
979347265 4:119603001-119603023 TCCTTAAGACATATGAATCATGG + Intronic
979842688 4:125464833-125464855 TTCTTAAGCAAGAAAGAGCAAGG + Intronic
980068894 4:128221600-128221622 ATCTTAAAACACATGGAGAAAGG - Intronic
980894391 4:138847863-138847885 TTTTTAAGTCAGTTTGAGCAGGG + Intergenic
983472793 4:168177047-168177069 CTCTTAACATAGTTGGAGCAAGG + Intronic
984049626 4:174847941-174847963 TTCTCAAAACAAATGAAGCATGG + Intronic
985103685 4:186482109-186482131 TTCTAATGAGAGAAGGAGCAGGG - Intronic
985173520 4:187176863-187176885 TATTTAAGACAGAGGGAGAAGGG + Intergenic
986289599 5:6389090-6389112 GTCTTCAGTGAGATGGAGCAGGG + Intergenic
987787962 5:22526641-22526663 TGCTGAAGACAGATGGATCTTGG - Intronic
987867007 5:23555186-23555208 TTTTAAAGATAGATGAAGCAAGG - Intergenic
988441746 5:31241623-31241645 GCTGTAAGACAGATGGAGCAGGG - Intronic
989206097 5:38810019-38810041 TACTTAAGAAAGATGGAGCTGGG + Intergenic
990054706 5:51558146-51558168 GTTTTAAGATAGTTGGAGCATGG + Intergenic
990238720 5:53795695-53795717 TTCTCTGGGCAGATGGAGCAGGG - Intergenic
992992411 5:82297922-82297944 TTCTTATGACAGAGGGAGTGGGG + Intronic
994402012 5:99292430-99292452 TTCTTTAGCCAGATGGATTAAGG + Intergenic
995752034 5:115462182-115462204 TTAGTAAGACAGAGGAAGCAAGG + Intergenic
997780811 5:136656246-136656268 TTCTTAAGACACATTTAGAATGG + Intergenic
998587643 5:143444188-143444210 CTCATAAGATAGCTGGAGCAAGG + Intergenic
999848784 5:155514981-155515003 TTCTTAAGCAAGTTTGAGCAGGG - Intergenic
1001753673 5:174150218-174150240 TTGTTGAGACGGATGGAGGAAGG - Intronic
1001870797 5:175153966-175153988 ATCTAAAGTCAGATGGAGAAAGG + Intergenic
1002984975 6:2180865-2180887 TACATAAGACAGATGGATGAAGG + Intronic
1004607503 6:17207534-17207556 AGCTGATGACAGATGGAGCAAGG + Intergenic
1004740844 6:18459217-18459239 TTCATTAGACAAATGGAGAAGGG - Intronic
1004741154 6:18462573-18462595 TTCATTAGACAAATGGAGAAAGG - Intronic
1008997706 6:57678260-57678282 TTCTTGAGGCAGATGGGGAAAGG - Intergenic
1009033514 6:58089417-58089439 TTTTTAAGACAGAAGGAGAGAGG + Intergenic
1009186200 6:60577605-60577627 TTCTTGAGGCAGATGGGGAAAGG - Intergenic
1009209124 6:60841130-60841152 TTTTTAAGACAGAAGGAGAGAGG + Intergenic
1009308525 6:62121397-62121419 TTCATAAGACAGATAGATCTTGG + Intronic
1012023534 6:93958381-93958403 TGATTAAGAAAGATAGAGCAAGG - Intergenic
1014400828 6:120987596-120987618 ATCAGGAGACAGATGGAGCAGGG - Intergenic
1014895576 6:126895681-126895703 TTCAAAAGACAGATGGATCTTGG + Intergenic
1016259311 6:142148668-142148690 TTATGAAGACAAATAGAGCAAGG + Intronic
1016899901 6:149091077-149091099 CTATCAAGACAGATGGAGTAAGG + Intergenic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1023590421 7:41775270-41775292 TTCCTAAGAAACACGGAGCAAGG - Intergenic
1025095499 7:56092704-56092726 TTCTGAAGGCGGATGGACCAGGG - Intronic
1029942840 7:104498071-104498093 TTCTTAAGGCAGATCTATCATGG + Intronic
1030253926 7:107485034-107485056 TAATTAAGAGAAATGGAGCATGG + Intronic
1030619224 7:111771250-111771272 TTCTTAAAAGAGATGGAGGTGGG - Intronic
1032511323 7:132474939-132474961 TTCATAAGAGAGATGGAGGGAGG + Intronic
1033284552 7:140029329-140029351 TTCAAAAGACATATGGATCAAGG + Intronic
1033834665 7:145294664-145294686 TGATTAAGACTGCTGGAGCAGGG - Intergenic
1034465545 7:151226559-151226581 TTCCTGAGAGGGATGGAGCAGGG - Intronic
1035143679 7:156790687-156790709 TTCTTAATACAGTTGGATCTAGG - Intronic
1036246288 8:7119846-7119868 TTCTGAGGACAGAGGCAGCAAGG + Intergenic
1037228285 8:16622268-16622290 TACTTAAGACAGATGGATCCTGG - Intergenic
1037959799 8:23088018-23088040 TTCTTAAGAGAGATTGAACAGGG + Intronic
1039743737 8:40405240-40405262 TCCTCAAGTTAGATGGAGCAGGG - Intergenic
1041738538 8:61135676-61135698 TTCTGAAGTCAGTTGGAGCCTGG + Intronic
1042362876 8:67902412-67902434 TTCCTAGGCCAGAAGGAGCAAGG - Intergenic
1045680315 8:104652423-104652445 TTCTTATCACAGATGAAGCATGG + Intronic
1046943076 8:119950108-119950130 TCCTTTCGACAGATGGTGCAGGG - Intronic
1047533736 8:125700261-125700283 TTCCAAACACAGATGGAGGAAGG + Intergenic
1047649745 8:126907452-126907474 TTTTTTAGCCAGTTGGAGCAAGG - Intergenic
1051297749 9:15614850-15614872 TTCTTAAGTTAGATGGGGAAGGG - Intronic
1052455686 9:28694406-28694428 TTGTTAATACAGATGTAGAAAGG - Intergenic
1052597731 9:30582088-30582110 TTTTTAAGACAGAAGGAATACGG + Intergenic
1057334035 9:94142107-94142129 TTCTGAGGTCAGAGGGAGCAGGG - Intergenic
1058175382 9:101729882-101729904 TTCTAAAGACCTATGCAGCAGGG + Intronic
1060195884 9:121623045-121623067 TGCTTAAGAGAGATGGCGCAAGG - Intronic
1060418119 9:123447258-123447280 TTCTCTAGATAAATGGAGCAAGG - Intronic
1061532317 9:131224392-131224414 TTTTTAAGACAGGTGGTCCAGGG + Intronic
1186103587 X:6182290-6182312 TTCCCAAGGGAGATGGAGCAAGG + Intronic
1188013583 X:25083668-25083690 ATCTTCACACAGATTGAGCATGG - Intergenic
1190775095 X:53546289-53546311 GTGTTACGACAGAGGGAGCATGG + Intronic
1193995045 X:88355268-88355290 TTCTTATGGCAGATGGAAAAGGG + Intergenic
1195173881 X:102296295-102296317 TTCTTCCGTCAGATGGAGCATGG + Intergenic
1195184984 X:102390798-102390820 TTCTTCCGTCAGATGGAGCATGG - Intronic
1198484417 X:137072436-137072458 TTCTTCATGCAGATGGATCATGG + Intergenic
1199386593 X:147230289-147230311 TTCATAAGAAAGATGGTTCATGG + Intergenic
1200250644 X:154552112-154552134 TTCTGAAGGCAGGTGCAGCATGG - Exonic