ID: 909622698

View in Genome Browser
Species Human (GRCh38)
Location 1:77685047-77685069
Sequence CTCTATAAGTAGAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909622698 Original CRISPR CTCTATAAGTAGAAAGAGCA AGG (reversed) Intergenic
901214362 1:7547308-7547330 CTCTCTCAGTAGATAGAGCTGGG + Intronic
903375183 1:22861311-22861333 CTCCTTAAGTGGAATGAGCATGG - Intronic
903749573 1:25612523-25612545 TTCTATACGTAGTGAGAGCAAGG - Intergenic
905775780 1:40666231-40666253 CTCTAGAAGTAGAGAGCGCAGGG - Intergenic
908173666 1:61532590-61532612 CTCTGAAAAAAGAAAGAGCATGG - Intergenic
908665946 1:66490902-66490924 CTCTGTAAGAAGAGAAAGCAAGG - Intergenic
909622698 1:77685047-77685069 CTCTATAAGTAGAAAGAGCAAGG - Intergenic
910349360 1:86277909-86277931 CTCCTTAAGCAGAAAGAGAAAGG + Intergenic
910661004 1:89672603-89672625 CTCTAGAAACAGAAAGACCAAGG + Intronic
910693420 1:89987774-89987796 CTCTAGATGGAGAAAGACCATGG - Intergenic
910977016 1:92917552-92917574 CTATATAAATAGAAAGTGAAAGG + Intronic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
912302415 1:108531815-108531837 CTCTGTGAGTGGGAAGAGCAGGG - Intergenic
914978334 1:152388143-152388165 CTCTAAAAGTAGAATGAGGTTGG - Intergenic
916508452 1:165449533-165449555 TTGAATAAGTGGAAAGAGCATGG + Intergenic
917566530 1:176217995-176218017 TTTTAAAAGTAGAAAGAGCCAGG - Intergenic
920945728 1:210526731-210526753 CTCTAATATTAGAAACAGCAAGG - Intronic
921655641 1:217733386-217733408 TTCACTAAGTAGAGAGAGCAGGG - Intronic
924310395 1:242735586-242735608 CTTTATATATTGAAAGAGCAAGG - Intergenic
1063774989 10:9252736-9252758 CACTATAGGGAGAAAAAGCATGG + Intergenic
1063844130 10:10106646-10106668 CTCTCTCAGGAGATAGAGCATGG - Intergenic
1065546472 10:26826734-26826756 CTCTATAACGTGAAAGTGCAAGG - Intronic
1067463075 10:46472489-46472511 CTCTCTCAGTGGACAGAGCAAGG - Intergenic
1067624118 10:47912149-47912171 CTCTCTCAGTGGACAGAGCAAGG + Intergenic
1067782920 10:49222010-49222032 CTCTCTAAGTAGAAAGTGACAGG - Intergenic
1070703199 10:78618324-78618346 CTCTGTAAGTAGACTGGGCAGGG - Intergenic
1071120875 10:82277412-82277434 ATCTATAAGTAAAATAAGCATGG - Intronic
1072273851 10:93802925-93802947 CACTATCAGGAGAAACAGCATGG - Intergenic
1075610922 10:123853990-123854012 CTATATAAGCAGAAAAAGCCAGG - Intronic
1077203379 11:1325925-1325947 ATCTAGAAATAGAAAGATCAAGG - Intergenic
1078154795 11:8790156-8790178 CTTTATAAGGAGACAGGGCAGGG - Intronic
1078306956 11:10198773-10198795 CTCTATAACATGAAAGTGCAAGG - Intronic
1080173802 11:29338259-29338281 CTCTACAAGTGGATTGAGCATGG + Intergenic
1080311131 11:30893886-30893908 CTCAATATGTAAAAAGAGCAAGG - Intronic
1080369026 11:31612615-31612637 GTATATAAGGAGAAAGAGAAGGG + Intronic
1080988125 11:37495718-37495740 CCCTATAAGGACAATGAGCACGG + Intergenic
1081089391 11:38844531-38844553 CTCTCTAAACAGAGAGAGCAGGG - Intergenic
1081491256 11:43570810-43570832 CTATAAAAGTAGAAAGAAAAGGG - Intronic
1084730215 11:71068190-71068212 ATCTACAAGTAGAAAGAGGAAGG + Intronic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1086013129 11:82130383-82130405 TTCTCCACGTAGAAAGAGCAAGG - Intergenic
1088664240 11:112078489-112078511 GTAAATAAGTACAAAGAGCAGGG - Intronic
1088752190 11:112853387-112853409 CTCTACAACTAGAAAGAGCAAGG - Intergenic
1090181947 11:124707462-124707484 CTCTATAGGAAAAAAAAGCAAGG + Intergenic
1093003070 12:14021635-14021657 CTCTAACAGAGGAAAGAGCAAGG - Intergenic
1093662142 12:21769257-21769279 CTCTATAAGTAGAACTATAAAGG + Intronic
1097342584 12:58455790-58455812 GTCAGTAAGCAGAAAGAGCAAGG - Intergenic
1098291557 12:68961616-68961638 CTGTATAAGTTGAATGAGCCAGG + Intronic
1099742588 12:86659902-86659924 CTCTATAAACTGCAAGAGCAGGG + Intronic
1100763903 12:97842035-97842057 CTTTCTAATTAGAAAGAGGAAGG + Intergenic
1102917705 12:116767038-116767060 ATATATAAGTAGTAACAGCAGGG - Intronic
1105075986 13:16023231-16023253 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105076184 13:16027154-16027176 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105076382 13:16031073-16031095 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105076576 13:16034989-16035011 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105076775 13:16038905-16038927 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105076984 13:16042826-16042848 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105077195 13:16046742-16046764 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105077403 13:16050655-16050677 CTCTTTTAGTAGAAAGTGCAAGG + Intergenic
1105077606 13:16054567-16054589 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105077803 13:16058481-16058503 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105077995 13:16062224-16062246 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105078196 13:16066141-16066163 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105078406 13:16070056-16070078 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105078599 13:16073802-16073824 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105078990 13:16081457-16081479 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105079199 13:16085376-16085398 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105079400 13:16089119-16089141 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105079596 13:16092866-16092888 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105079997 13:16100526-16100548 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105080212 13:16104443-16104465 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105080415 13:16108358-16108380 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1105664664 13:22540309-22540331 CTACATTAGTAGAAAGACCACGG - Intergenic
1108286883 13:48917651-48917673 CTCCAGAAGTAGAAAAGGCAAGG - Intergenic
1110828118 13:79997002-79997024 CTTTATAAATTGAAAGAGCAGGG - Intergenic
1110933069 13:81247443-81247465 CTTTATAAGTTTAAAGTGCAAGG + Intergenic
1111004994 13:82236015-82236037 AACTAGAAGTAGAAAGAGCATGG - Intergenic
1112057188 13:95700574-95700596 GTTTAGAAGGAGAAAGAGCAAGG + Intronic
1112840916 13:103576718-103576740 CTTTATTAGTAGAATGAGAATGG + Intergenic
1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG + Intergenic
1114204780 14:20558705-20558727 CTCGGGAAGTAGAAAGGGCAGGG - Intronic
1114429678 14:22650054-22650076 GACTATGAGTAGAAAGAGCCAGG + Intergenic
1114581434 14:23763941-23763963 ATCTTTAAGTGGAAAAAGCAAGG + Intergenic
1114660672 14:24341787-24341809 CTTTAAAAGAAGGAAGAGCAGGG + Intergenic
1118648737 14:67867587-67867609 CTCTATATGTAAAAAGAGGCTGG + Intronic
1119453357 14:74731862-74731884 CACTGTTAATAGAAAGAGCATGG + Intronic
1119861813 14:77941429-77941451 CCCTACAGGAAGAAAGAGCAAGG - Intergenic
1120035800 14:79696616-79696638 TTTTATAAGTAGAAAGAGTTGGG + Intronic
1120947315 14:90010669-90010691 CTCTAGAACTAGAAAAGGCAAGG + Intronic
1123001598 14:105298234-105298256 CTCTAAAATTAAAAAGAGAAAGG + Intronic
1123226526 15:17040604-17040626 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1124806054 15:32884293-32884315 CTCTAGAAGTGGAAAAGGCAAGG - Intronic
1127191262 15:56533023-56533045 AGCTATAATTATAAAGAGCAGGG + Intergenic
1127224607 15:56917015-56917037 CCCTGTAAGTAGGCAGAGCAGGG + Intronic
1127447079 15:59074464-59074486 CTCTATAAGATAAAAGTGCAAGG - Intronic
1129024423 15:72556406-72556428 CTCAATAAGTAGAAAGAGCTGGG + Intronic
1129946303 15:79542015-79542037 CCCTAAAAATAGTAAGAGCATGG - Intergenic
1132025253 15:98399611-98399633 CCCTATAAGAAGAAACCGCAGGG + Intergenic
1133208325 16:4247698-4247720 CTCATTCGGTAGAAAGAGCAGGG - Intergenic
1134270924 16:12732323-12732345 CTCAAAAAGTAGAGTGAGCAAGG + Intronic
1135714571 16:24751092-24751114 TTTTATAAGTGGGAAGAGCATGG + Intronic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1141135514 16:81462519-81462541 TTCATTAAGTAGAAAGATCAAGG + Intronic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1144908001 17:18653504-18653526 CCGTTTCAGTAGAAAGAGCATGG + Intronic
1145554587 17:24753993-24754015 CTCTTTTTGTAGAAAGTGCAAGG + Intergenic
1145773777 17:27512132-27512154 CACTACAGGGAGAAAGAGCAGGG - Intronic
1146378217 17:32309243-32309265 AACTAAAAGTAGAAAAAGCATGG + Intronic
1147310989 17:39596117-39596139 CTCTATAAGAACAAAGAGTCAGG + Intergenic
1149186977 17:54009522-54009544 CTCTAAAATAAGAAAGATCAAGG - Intergenic
1151118497 17:71766245-71766267 CTATATTAGTAGTAGGAGCAGGG - Intergenic
1151139516 17:71978030-71978052 CTCTAGAAGTTGAAAAGGCAAGG + Intergenic
1155015138 18:21829554-21829576 CTCTAGAAGTTGAAACAACAAGG + Intronic
1155026610 18:21946347-21946369 CTCTAGAAGTAGAAAAGTCAAGG - Intergenic
1156194365 18:34757137-34757159 CTCTAAAAGTGGAAAAAGCAAGG - Intronic
1156627144 18:38922837-38922859 CCCAATAAACAGAAAGAGCATGG - Intergenic
1159574306 18:70156850-70156872 TGCCAGAAGTAGAAAGAGCAGGG + Intronic
1162298881 19:9832627-9832649 CCCTCTAAGTGGATAGAGCAAGG - Intergenic
1162660043 19:12161695-12161717 CTCTATACATAGAAAAATCAAGG - Intergenic
927410792 2:22823838-22823860 ATTTTTAAGTAGAAAGACCAAGG + Intergenic
927999869 2:27514142-27514164 CCCTATCAGTAGAAAGAATAAGG + Intronic
928591663 2:32823200-32823222 CTCTAGAAAGAGAAAGAGCCAGG + Intergenic
929215423 2:39406472-39406494 CTCTTTAAGCAGCAAGAGAAAGG + Intronic
929235664 2:39603068-39603090 AGCTATAAGTAGAGAGAGAATGG - Intergenic
931865939 2:66411933-66411955 ATCTCTATGTAGAAAAAGCAAGG - Intergenic
932856385 2:75237801-75237823 CTCCAAAAGTAGGAAGTGCAAGG - Intergenic
934621459 2:95811565-95811587 CTCTCTAAGCAGAGAGAACAGGG + Intergenic
934811984 2:97287250-97287272 CTCTCTAAGCAGAGAGAACAGGG - Intergenic
934825709 2:97420677-97420699 CTCTCTAAGCAGAGAGAACAGGG + Intergenic
935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG + Intergenic
936017082 2:108967583-108967605 CTATAAAACTTGAAAGAGCAGGG + Intronic
939764990 2:146237114-146237136 GTCTATAAATAGAAAATGCATGG + Intergenic
940717180 2:157239252-157239274 ATTTATAATTAGAAGGAGCAAGG - Intergenic
941521865 2:166555049-166555071 CTTTTGAAGTAGAAAGAGAAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944270225 2:197775097-197775119 CTTAATAAGTAGAAAGAGTGAGG + Intronic
944832686 2:203548881-203548903 CTCCAGAAGAAAAAAGAGCAGGG - Intergenic
945406236 2:209452221-209452243 CTCTACAAGTAGACAGAGTAGGG + Intronic
946123001 2:217532823-217532845 TTCAATAAGTGGAAAGAGGAGGG - Intronic
1169001826 20:2173458-2173480 CCCTGTATGTAGACAGAGCAGGG + Intronic
1169787327 20:9373441-9373463 CTCATTAAATAGAAAGAGAATGG + Intronic
1171743599 20:28935752-28935774 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176165533 20:63671390-63671412 CTCTATTAATAGAAAAGGCAGGG + Intronic
1176323834 21:5366573-5366595 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1176481598 21:7300578-7300600 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1176531827 21:7972060-7972082 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176532027 21:7975973-7975995 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176532229 21:7979883-7979905 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176532439 21:7983966-7983988 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176532650 21:7988050-7988072 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176532864 21:7992136-7992158 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176533084 21:7996383-7996405 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176533286 21:8000298-8000320 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176533486 21:8004213-8004235 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176533696 21:8008128-8008150 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176533903 21:8012040-8012062 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176534109 21:8015952-8015974 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176534307 21:8019868-8019890 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176534419 21:8022248-8022270 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176534966 21:8032640-8032662 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176535164 21:8036555-8036577 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1176535364 21:8040466-8040488 CTCTTTTAGTAGAAACTGCAAGG - Intergenic
1178331449 21:31697630-31697652 GTCTATAAGCAGAATGAGCACGG - Intronic
1178761808 21:35410361-35410383 CTCTCTAAGTATAAAGAGCAAGG - Intronic
1180400365 22:12413857-12413879 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1180990742 22:19934232-19934254 CTCTAAAAGGAGAAACTGCAGGG + Intronic
1181716935 22:24737856-24737878 CTCTATGTGTAGAAAGAGAAGGG + Intronic
1182348478 22:29684000-29684022 CTCTATGAGCAGAAACTGCAGGG - Intronic
1182817530 22:33179051-33179073 CTTTATAAGAAGAAACATCAAGG - Intronic
1182886496 22:33778170-33778192 CTCTATAAGGATAAAGCACAGGG + Intronic
1184618064 22:45651625-45651647 CTCTAAAAGTAGAAAAGACAGGG + Intergenic
1185123854 22:48993057-48993079 CTCCATGGGCAGAAAGAGCAGGG - Intergenic
949103367 3:173587-173609 CTCTATATATAGAGAGAGAAAGG + Intergenic
949529792 3:4944534-4944556 CTCTGTAAGGAGACAGAGCCAGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
951623778 3:24636836-24636858 CTCTATAACGGGAAATAGCAAGG - Intergenic
951792957 3:26506885-26506907 CTCCACAAGCAGAGAGAGCAGGG - Intergenic
953108428 3:39908591-39908613 TTCTTAAAGTAGAAAGAACATGG + Intronic
953160337 3:40413942-40413964 CTCAGGAAGAAGAAAGAGCAAGG - Intronic
953636074 3:44666062-44666084 CTCTATAAAGAGAAAAAACATGG - Intergenic
953735459 3:45490433-45490455 TTCAATAAGTAGAAGGAGAATGG + Intronic
954005000 3:47583641-47583663 CTCTATAGGTTAAAAGCGCATGG + Intergenic
954406757 3:50349487-50349509 CTCTCTAGCTAGACAGAGCATGG + Exonic
959118449 3:102205817-102205839 CTCTGTTTGTAGAAAGAGGAAGG - Intronic
959902989 3:111680687-111680709 GTCTATAAACAGAAAGATCATGG + Intronic
965866976 3:173216543-173216565 CTCTGTCTGTGGAAAGAGCAAGG - Intergenic
966164186 3:176998524-176998546 CTCTGGAAGTGGAAACAGCAAGG + Intergenic
966690961 3:182740942-182740964 CTGTAACAGTAGAATGAGCAAGG - Intergenic
967420486 3:189266812-189266834 CTTTGTAACTAGAAAGATCAAGG - Intronic
968244493 3:197129285-197129307 CTCTATAACATGAAAGTGCAAGG - Intronic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
972120125 4:35691495-35691517 CTCTAAAAGTAGATAAAGCTAGG + Intergenic
972208601 4:36809338-36809360 CTCTATAATTAAAAACAGTATGG - Intergenic
972569840 4:40300563-40300585 CTCTACTAGTAGATAGAGCCTGG + Intergenic
972583822 4:40418877-40418899 CTCTATTAGTAGCATGAGAATGG - Intergenic
972929383 4:44052385-44052407 CTCTCCAAGTACAAAGAGCATGG + Intergenic
973846876 4:54921811-54921833 CTTCATAAGTGGAAAGAGCTGGG - Intergenic
975833897 4:78400240-78400262 CTCTATAAGAAGCTTGAGCAGGG - Intronic
976908857 4:90275144-90275166 CTTTATAAGTAGCCAGAACATGG + Intronic
976913880 4:90345055-90345077 CTCTTTTAATGGAAAGAGCATGG - Intronic
977104903 4:92869773-92869795 CCCTAAAAGTAGTCAGAGCATGG + Intronic
977269362 4:94897224-94897246 CTATATAAGCAGGAAGAGCTGGG - Intronic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
979743915 4:124185735-124185757 ATCTAGAAGTAGAAAGAACTAGG - Intergenic
980771139 4:137374554-137374576 CACTATAATCAGAAAGAGCATGG + Intergenic
982641524 4:157967779-157967801 GTATACAAGTAGAAAGAACATGG - Intergenic
982770659 4:159393878-159393900 TTCTAAAATTAGAAAGAGCCAGG + Intergenic
984390588 4:179126468-179126490 CCCTATAAATAAAAAGAGAAAGG - Intergenic
984450851 4:179899252-179899274 CTCCTTAAGTAGAACCAGCAAGG + Intergenic
985394453 4:189526729-189526751 CTTTATTAGTAGCAAGAGAATGG + Intergenic
985981004 5:3463311-3463333 CTCTATAAATATAATGGGCAAGG + Intergenic
986050515 5:4085755-4085777 ATCAACAAGTAGAAAGAACAGGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987129346 5:14846344-14846366 CTCTATAATGAGGAATAGCACGG - Intronic
987940943 5:24535633-24535655 CTTTATCAGTAGAAAGACCATGG - Intronic
990026618 5:51199326-51199348 TCTTATAAGTAGAAAGATCAAGG - Intergenic
990087558 5:51997436-51997458 ATCTAAAAGTAGAAAGAACAGGG + Intergenic
990208515 5:53455781-53455803 CTACATAACTACAAAGAGCAGGG + Intergenic
990983316 5:61620478-61620500 CTGTATAAATAAAAAGAGTAAGG + Intergenic
991228664 5:64303713-64303735 CTCTATAACAAAAAAGTGCAAGG + Intronic
991929410 5:71737665-71737687 CTCTATAAGTAGTAGTTGCAAGG - Intergenic
992753668 5:79884567-79884589 CTCTATGCTGAGAAAGAGCAAGG + Intergenic
992836048 5:80642396-80642418 CTCCATAAGAAAAAAGTGCAAGG + Intronic
994020099 5:95013272-95013294 CTCTATGACATGAAAGAGCAAGG + Intronic
995853025 5:116566517-116566539 CTCTGTAAGTGGAAACAGAATGG - Intronic
996483654 5:124004290-124004312 CTCTAGAGGCAGAAAGAGCTTGG - Intergenic
996642651 5:125776047-125776069 CTCTGTAAGTGGAAAAGGCAAGG - Intergenic
996704913 5:126487826-126487848 CTATATAACTACAAAGACCATGG + Intronic
997569685 5:134916873-134916895 CTCTGTGAGCAGACAGAGCATGG + Intronic
1000643079 5:163728070-163728092 ATCTATAAGTAAAATGAGCAAGG - Intergenic
1001218666 5:169879847-169879869 CTATATAAGTAAAAAGGGCAAGG - Intronic
1002411363 5:179079999-179080021 CTCTATAAGTGGAAGGAATATGG + Exonic
1003200868 6:3959017-3959039 TTCTATAATTAGACTGAGCAGGG + Intergenic
1006020207 6:31113285-31113307 CTCTAGAAGGTGAAAAAGCAGGG - Intergenic
1006206749 6:32350927-32350949 CTCTAGAAGCTGAAAAAGCAAGG + Intronic
1008567542 6:52784144-52784166 CTCTATAAGAAGAAAGCACTAGG + Intergenic
1009557486 6:65192568-65192590 CTCTAAAAATAGTAAGAGCTCGG - Intronic
1011430526 6:87281627-87281649 GTCTGTAACTAGAAAGAGTATGG + Intergenic
1012228252 6:96729897-96729919 CTCTAGAAGCAGAAAAGGCAAGG + Intergenic
1012661909 6:101909278-101909300 CTCTATAAATAGGAACAGGAAGG + Intronic
1012940530 6:105410070-105410092 CTCTACCAGTAGAAAGGGTAGGG + Intergenic
1012979620 6:105815896-105815918 CTCTATAAGAAGTAACAGAAAGG + Intergenic
1013580469 6:111529175-111529197 CTTTATAAGTAGATAGAGTGGGG + Intergenic
1014506265 6:122261968-122261990 CTCTATCAGCAGAAAAAGCTGGG - Intergenic
1015363515 6:132370255-132370277 CTCTACTAGAAAAAAGAGCATGG + Intronic
1015439464 6:133231706-133231728 CTCCATGAGCAGACAGAGCATGG + Intergenic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1016280207 6:142408474-142408496 CTCAATAATCAGAAAGAGAAGGG + Intronic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1019102236 6:169640877-169640899 CTCACTAAGAAGGAAGAGCATGG - Intronic
1021002440 7:15349406-15349428 CTTTATAGGTTGAAAGGGCATGG + Intronic
1023395800 7:39750868-39750890 CTGTTTAAGTAGGAAGATCAGGG - Intergenic
1026875557 7:73877214-73877236 CTCTCTGGGTAGCAAGAGCAGGG + Intergenic
1027497074 7:78901153-78901175 ATCTATAAGTTTAAGGAGCAGGG + Intronic
1027693568 7:81379548-81379570 TTCTATAAATAGAAAGAAAAGGG + Intergenic
1028660703 7:93269666-93269688 CTCTATAAGAAGCAAATGCAAGG + Intronic
1028803274 7:94993756-94993778 CTCTATTAGTAGAAGTAGCTTGG + Intronic
1030283173 7:107798040-107798062 TTCTATAATTAGTAAGAGGAAGG - Intronic
1030995363 7:116352903-116352925 GTCAAGAAGTAGAAGGAGCATGG - Intronic
1031554635 7:123157612-123157634 TTTTACAACTAGAAAGAGCAAGG - Intronic
1032645776 7:133822511-133822533 CTCTCTAAGTAGCAAGGGTATGG - Intronic
1032837359 7:135686534-135686556 CTCTACAAATAAAAAGAGCAGGG - Intronic
1033534396 7:142298687-142298709 AGCCATAAGTAGAAAGAGGAAGG + Intergenic
1034028206 7:147731083-147731105 CTCTATAACGTGAAAGTGCAAGG + Intronic
1036540916 8:9709786-9709808 CACTATACGTAGAAAGAATATGG + Intronic
1036570181 8:9973598-9973620 TTCTATGAATAGAAAGAGAAGGG + Intergenic
1039277129 8:35945616-35945638 CTTTGCAAGTAGGAAGAGCATGG - Intergenic
1041625851 8:60025780-60025802 TGCTATAAGGAGGAAGAGCAAGG - Intergenic
1044114552 8:88318962-88318984 CTTTATAAGTAGGAATAACATGG - Intronic
1046266278 8:111835080-111835102 CTCTAGAAGCCGGAAGAGCAAGG + Intergenic
1046827521 8:118707457-118707479 CTATATAAGAACAAAGAACAAGG + Intergenic
1049012120 8:139894216-139894238 CTCGACAGGTAGAAAGTGCAGGG - Intronic
1049713085 8:144075670-144075692 TTCTATATGTAGAAAGAATATGG - Intergenic
1050662736 9:7900865-7900887 CTCTTTAAGTGGGAAGAACATGG + Intergenic
1050880517 9:10694146-10694168 CTCTTTTAGTTGAAAGAGCATGG + Intergenic
1052724264 9:32210993-32211015 CTCTATAACATGAAAGTGCAAGG + Intergenic
1053686200 9:40526312-40526334 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1055112662 9:72575077-72575099 CTATATAAGTAGAAAGATGGAGG - Intronic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1057412784 9:94832731-94832753 CTTGTTAAGTAAAAAGAGCAAGG + Intronic
1058578858 9:106433052-106433074 TTCAAGAAGTAGAAAGAACATGG + Intergenic
1058747056 9:108001946-108001968 CTTGAGAGGTAGAAAGAGCAAGG + Intergenic
1203381407 Un_KI270435v1:50145-50167 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1203400800 Un_KI270519v1:94134-94156 CTCTTTTAGTAGAAACTGCAAGG + Intergenic
1185623496 X:1467272-1467294 CTCTGGAGGAAGAAAGAGCAGGG - Intronic
1186567075 X:10674632-10674654 CTTTATAACCAGAATGAGCATGG + Intronic
1186642994 X:11476177-11476199 AGCTATAAGTAGATTGAGCATGG + Intronic
1187128170 X:16474150-16474172 TTATAAAAGTAGAAAGAGAATGG + Intergenic
1188459020 X:30401497-30401519 CACTAGAAGTAAAAAGAGAAAGG - Intergenic
1189521039 X:41768348-41768370 CTCTCTAAGTGGACAGAGCTAGG + Intronic
1191659396 X:63634632-63634654 TGCTATAAGGAAAAAGAGCAAGG + Intergenic
1191976316 X:66875707-66875729 TTTTATAAGTAGCAACAGCAAGG - Intergenic
1192825460 X:74691666-74691688 CTCTATAAGCCAAAAGAGCGTGG - Intergenic
1193567146 X:83090803-83090825 TTCTATAAGGAGAAAGAATATGG + Intergenic
1194532571 X:95069316-95069338 CTCTATATTTGGAAAGAGGAGGG + Intergenic
1195909802 X:109877444-109877466 CTATACAAGTGGAAAGAACAGGG - Intergenic
1196100099 X:111838869-111838891 TTCAAAAAGTAGAAAGAGTATGG + Intronic
1196339360 X:114580069-114580091 CTCAAAAAGGAGAAAGAGCTAGG - Intergenic
1198529608 X:137538263-137538285 CTTTAAAGGTAGAAAGAGAAAGG - Intergenic
1198724072 X:139658263-139658285 CTCTATAAGAAGGAAGAGATTGG + Intronic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1199034964 X:143039466-143039488 CCATATAAGAAGAAAGAGAAAGG - Intergenic
1200038683 X:153350126-153350148 CTCTAGAACTAGAAAGAGATTGG + Exonic