ID: 909623105

View in Genome Browser
Species Human (GRCh38)
Location 1:77687542-77687564
Sequence CTCACTTCCCAGATGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909623105_909623119 18 Left 909623105 1:77687542-77687564 CCCCACCCCATCTGGGAAGTGAG No data
Right 909623119 1:77687583-77687605 CCCACCCCGTCTAGGAAGTGAGG No data
909623105_909623114 10 Left 909623105 1:77687542-77687564 CCCCACCCCATCTGGGAAGTGAG No data
Right 909623114 1:77687575-77687597 GACCGGCCCCCACCCCGTCTAGG No data
909623105_909623112 -7 Left 909623105 1:77687542-77687564 CCCCACCCCATCTGGGAAGTGAG No data
Right 909623112 1:77687558-77687580 AAGTGAGGAGCGCCTCTGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909623105 Original CRISPR CTCACTTCCCAGATGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr