ID: 909623105 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:77687542-77687564 |
Sequence | CTCACTTCCCAGATGGGGTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
909623105_909623119 | 18 | Left | 909623105 | 1:77687542-77687564 | CCCCACCCCATCTGGGAAGTGAG | No data | ||
Right | 909623119 | 1:77687583-77687605 | CCCACCCCGTCTAGGAAGTGAGG | No data | ||||
909623105_909623114 | 10 | Left | 909623105 | 1:77687542-77687564 | CCCCACCCCATCTGGGAAGTGAG | No data | ||
Right | 909623114 | 1:77687575-77687597 | GACCGGCCCCCACCCCGTCTAGG | No data | ||||
909623105_909623112 | -7 | Left | 909623105 | 1:77687542-77687564 | CCCCACCCCATCTGGGAAGTGAG | No data | ||
Right | 909623112 | 1:77687558-77687580 | AAGTGAGGAGCGCCTCTGACCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
909623105 | Original CRISPR | CTCACTTCCCAGATGGGGTG GGG (reversed) | Intergenic | ||
No off target data available for this crispr |